TB-Profiler result

Run: ERR4830884

Summary

Run ID: ERR4830884

Sample name:

Date: 01-04-2023 20:31:32

Number of reads: 1411752

Percentage reads mapped: 99.58

Strain: lineage4.2.1

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.2 Euro-American H;T;LAM None 1.0
lineage4.2.1 Euro-American (TUR) H3;H4 None 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Asn missense_variant 1.0 isoniazid
pncA 2288826 p.Val139Gly missense_variant 1.0 pyrazinamide
embB 4248002 p.Gln497Lys missense_variant 1.0 ethambutol
gid 4407796 p.Ser136* stop_gained 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764817 p.Val483Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304849 p.Asn640Ser missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
PPE35 2168945 c.1668T>C synonymous_variant 0.11
PPE35 2169879 p.Phe245Cys missense_variant 1.0
Rv1979c 2223284 c.-120C>T upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ahpC 2726109 c.-84_-83insA upstream_gene_variant 1.0
ald 3086742 c.-78A>C upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4267823 c.1014G>C synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408149 c.54T>C synonymous_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0