TB-Profiler result

Run: ERR9787173

Summary

Run ID: ERR9787173

Sample name:

Date: 02-04-2023 13:04:09

Number of reads: 2775882

Percentage reads mapped: 79.27

Strain: lineage6

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage6 West-Africa 2 AFRI_1 RD702 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8493 p.Leu398Phe missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491668 p.Lys296Glu missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 760855 p.Thr350Ile missense_variant 1.0
rpoB 760969 p.Ser388Leu missense_variant 1.0
rpoB 761723 p.Glu639Asp missense_variant 0.99
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 766231 c.2862T>C synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
Rv1258c 1406685 p.Val219Ala missense_variant 1.0
embR 1416633 p.Leu239Val missense_variant 1.0
atpE 1461251 c.207G>T synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472544 n.699C>G non_coding_transcript_exon_variant 0.13
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.12
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.22
rrs 1472570 n.725G>A non_coding_transcript_exon_variant 0.24
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.24
rrs 1472575 n.730C>T non_coding_transcript_exon_variant 0.21
rrs 1472579 n.734G>C non_coding_transcript_exon_variant 0.21
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.25
rrs 1472591 n.746G>A non_coding_transcript_exon_variant 0.26
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.3
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.34
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.28
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.26
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.26
rrs 1472665 n.820G>A non_coding_transcript_exon_variant 0.25
rrs 1472669 n.824_825insTAGA non_coding_transcript_exon_variant 0.27
rrs 1472678 n.833T>G non_coding_transcript_exon_variant 0.26
rrs 1472679 n.834T>C non_coding_transcript_exon_variant 0.26
rrs 1472682 n.839_843delGGGAT non_coding_transcript_exon_variant 0.26
rrs 1472689 n.844C>T non_coding_transcript_exon_variant 0.26
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.26
rrs 1472695 n.850C>T non_coding_transcript_exon_variant 0.26
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.27
rrs 1472701 n.856T>A non_coding_transcript_exon_variant 0.27
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.3
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.3
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.35
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.33
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.25
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.25
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.15
rrs 1472827 n.982G>T non_coding_transcript_exon_variant 0.13
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.13
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.15
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.12
rrs 1473053 n.1208T>A non_coding_transcript_exon_variant 0.13
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.13
rrs 1473062 n.1217T>A non_coding_transcript_exon_variant 0.13
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.14
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.23
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.24
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.25
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.24
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.25
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.24
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.24
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.23
rrl 1476301 n.2644A>C non_coding_transcript_exon_variant 0.24
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.23
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.24
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.24
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.24
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.26
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.3
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.31
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.32
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.3
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.3
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.3
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.23
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.25
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.23
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.23
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.21
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.11
inhA 1674434 p.Val78Ala missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168990 c.1545_1622delGGCGATGACGCCAGCTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGC disruptive_inframe_deletion 1.0
PPE35 2169071 c.1542A>G synonymous_variant 0.23
Rv1979c 2222308 p.Asp286Gly missense_variant 0.99
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
Rv2752c 3066362 c.-171G>A upstream_gene_variant 1.0
thyA 3073693 p.Pro260Leu missense_variant 1.0
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
fprA 3473914 c.-93G>T upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
Rv3236c 3612143 p.Arg325His missense_variant 1.0
fbiB 3641106 c.-429C>T upstream_gene_variant 1.0
alr 3841449 c.-29C>T upstream_gene_variant 1.0
rpoA 3878656 c.-149C>A upstream_gene_variant 0.17
embC 4240671 p.Thr270Ile missense_variant 1.0
embC 4241537 p.Gly559Ser missense_variant 1.0
embC 4241843 p.Leu661Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embA 4244379 p.Pro383Ser missense_variant 1.0
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269522 c.-686C>T upstream_gene_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
ethA 4326465 p.Ile337Val missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4408034 p.Glu57Lys missense_variant 1.0
PPE35 2168990 c.1544_1622delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0