TB-Profiler result

Run: SRR1146302

Summary

Run ID: SRR1146302

Sample name:

Date: 02-04-2023 21:31:37

Number of reads: 5078592

Percentage reads mapped: 99.22

Strain: lineage3

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 0.97
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 0.99
gyrA 8056 p.Arg252Leu missense_variant 0.98
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 0.99
rpoC 762434 c.-936T>G upstream_gene_variant 0.99
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304260 p.Trp444Arg missense_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 0.99
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 0.97
pncA 2289365 c.-125delC upstream_gene_variant 0.97
ahpC 2726105 c.-88G>A upstream_gene_variant 0.99
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 0.17
embC 4242075 p.Arg738Gln missense_variant 0.95
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4328212 c.-740delC upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4408156 c.24_46delGTCTGCGATCTTCGGACCGCGGC frameshift_variant 0.96