TB-Profiler result

Run: SRR17111238
Summary

Run ID: SRR17111238

Sample name:

Date: 03-04-2023 17:54:06

Number of reads: 1918623

Percentage reads mapped: 98.98

Strain: La1.7

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
La1 M.bovis None None 1.0
La1.7 M.bovis None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
pncA 2289073 p.His57Asp missense_variant 1.0 pyrazinamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5357 p.Arg40Cys missense_variant 1.0
gyrB 5752 c.513G>A synonymous_variant 1.0
gyrA 6406 c.-896C>T upstream_gene_variant 1.0
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8285 c.984C>T synonymous_variant 1.0
gyrA 8514 p.Ile405Val missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9217 p.Asp639Ala missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 777046 p.Ser479Pro missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472544 n.699C>T non_coding_transcript_exon_variant 0.15
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.15
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.15
rrs 1472573 n.728C>T non_coding_transcript_exon_variant 0.14
rrs 1472574 n.729T>A non_coding_transcript_exon_variant 0.14
rrs 1472579 n.734G>A non_coding_transcript_exon_variant 0.14
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.14
rrs 1472592 n.747C>T non_coding_transcript_exon_variant 0.14
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.14
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.14
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.14
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.18
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.18
rrs 1472659 n.814G>A non_coding_transcript_exon_variant 0.18
rrs 1472670 n.825G>T non_coding_transcript_exon_variant 0.19
rrs 1472672 n.828_838delTTTCCTTCCTT non_coding_transcript_exon_variant 0.19
rrs 1472690 n.845C>G non_coding_transcript_exon_variant 0.18
rrs 1472698 n.853A>C non_coding_transcript_exon_variant 0.18
rrs 1472701 n.856T>A non_coding_transcript_exon_variant 0.18
rrs 1472715 n.870C>T non_coding_transcript_exon_variant 0.18
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.18
rrs 1472719 n.874G>A non_coding_transcript_exon_variant 0.18
rrs 1472733 n.888G>T non_coding_transcript_exon_variant 0.16
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.16
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.16
rrs 1472742 n.897C>A non_coding_transcript_exon_variant 0.16
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.16
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.14
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.14
rrl 1475729 n.2072C>T non_coding_transcript_exon_variant 0.29
rrl 1475904 n.2247G>C non_coding_transcript_exon_variant 0.5
rrl 1476185 n.2528G>A non_coding_transcript_exon_variant 0.4
rpsA 1834859 p.Ala440Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102909 p.Arg45His missense_variant 1.0
ndh 2103173 c.-132delG upstream_gene_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 1.0
katG 2156025 c.87C>A synonymous_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168011 p.Ser868Arg missense_variant 0.98
PPE35 2168319 p.Thr765Ile missense_variant 1.0
PPE35 2168814 c.1798dupA frameshift_variant 1.0
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3086856 p.Glu13Lys missense_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
Rv3083 3448783 p.Val94Ile missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474427 p.Val141Ile missense_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
rpoA 3878630 c.-124delC upstream_gene_variant 1.0
clpC1 4038403 c.2302T>C synonymous_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4242970 c.-263C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embB 4246551 p.Asn13Ser missense_variant 1.0
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
embB 4248877 c.2364C>T synonymous_variant 1.0
aftB 4267858 p.Ile327Val missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0