TB-Profiler result

Run: SRR17111243

Summary

Run ID: SRR17111243

Sample name:

Date: 2024-04-14T10:56:12.177671

Number of reads: 2894462

Percentage reads mapped: 99.35

Median coverage: 143.0

Strain: La2

Spoligotype:

Drug-resistance: Other


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
La2 M.caprae None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Assoc w R - Interim
c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT Assoc w R - Interim
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.21 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
dnaA 467 p.His156Arg missense_variant 1.0 isoniazid Not assoc w R
gyrB 5752 c.513G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6307 c.1068T>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6446 p.Ala403Ser missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Uncertain significance
gyrA 7275 c.-27C>T upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8285 c.984C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9143 c.1842T>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13197 p.Thr121Ser missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13228 c.330delG frameshift_variant 1.0 isoniazid Uncertain significance
Rv0010c 13460 c.99T>C synonymous_variant 1.0 isoniazid Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
Rv0565c 657578 c.-108T>C upstream_gene_variant 1.0 ethionamide
hadA 731910 c.-20A>G upstream_gene_variant 1.0 isoniazid Uncertain significance
nusG 734759 p.Ala169Val missense_variant 1.0 rifampicin Uncertain significance
rpoB 759719 c.-88C>A upstream_gene_variant 1.0 rifampicin Uncertain significance
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1253599 c.936G>A synonymous_variant 1.0 moxifloxacin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
Rv1258c 1406212 p.His377Tyr missense_variant 1.0 streptomycin
isoniazid
pyrazinamide
embR 1417554 c.-207C>G upstream_gene_variant 1.0 ethambutol
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
inhA 1673766 c.-436C>T upstream_gene_variant 1.0 ethionamide Uncertain significance
isoniazid Uncertain significance
rpsA 1834859 p.Ala440Thr missense_variant 1.0 pyrazinamide Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tsnR 1854367 c.762T>C synonymous_variant 1.0 linezolid Not assoc w R - Interim
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2062922 p.Ile603Val missense_variant 1.0 streptomycin Not assoc w R
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2155503 c.609C>T synonymous_variant 1.0 isoniazid Not assoc w R
katG 2156025 c.87C>A synonymous_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2168364 p.Thr750Met missense_variant 1.0 pyrazinamide Uncertain significance
PPE35 2168748 c.1850_1864delCACCCCAAATAAGTA disruptive_inframe_deletion 1.0 pyrazinamide
PPE35 2170876 c.-264C>T upstream_gene_variant 1.0 pyrazinamide
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
eis 2714317 p.Arg339Gln missense_variant 1.0 amikacin Uncertain significance
kanamycin Uncertain significance
Rv2681 2997325 p.Ala196Val missense_variant 1.0 capreomycin Uncertain significance
thyX 3067262 c.684C>T synonymous_variant 1.0 para-aminosalicylic_acid
ald 3086728 c.-92C>T upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3087084 c.266delA frameshift_variant 1.0 cycloserine
Rv3083 3448783 p.Val94Ile missense_variant 1.0 ethionamide Uncertain significance
Rv3236c 3613566 c.-450T>G upstream_gene_variant 1.0 pyrazinamide
lpqB 3623730 p.Ser394Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3624350 c.561G>T synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3624486 p.Asp142Gly missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3624593 c.318G>A synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3624710 c.201G>A synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
fbiB 3641584 p.Val17Ala missense_variant 0.31 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
glpK 4138377 p.Val460Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4240671 p.Thr270Ile missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embC 4242970 c.3108C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4244220 c.988C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4246864 c.351C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4247646 p.Glu378Ala missense_variant 1.0 ethambutol Not assoc w R
aftB 4267782 p.Val352Gly missense_variant 1.0 ethambutol Uncertain significance
aftB 4267858 p.Ile327Val missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269088 p.Ala249Val missense_variant 1.0 ethambutol Uncertain significance
ubiA 4269351 c.483C>T synonymous_variant 1.0 ethambutol Not assoc w R
ubiA 4269387 p.Glu149Asp missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269606 c.228T>C synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R