TB-Profiler result

Run: SRR1792046


Run ID: SRR1792046

Sample name:

Date: 2024-03-24T17:01:26.444870

Number of reads: 2511024

Percentage reads mapped: 99.55

Median coverage: 102.0

Strain: La1.8.1


Drug-resistance: Other

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
La1.8 M.bovis None 1.0
La1.8.1 M.bovis None 1.0
La1 M.bovis None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
pyrazinamide pncA p.His57Asp Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
pncA 2289073 p.His57Asp missense_variant 0.98 pyrazinamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
dnaA 467 p.His156Arg missense_variant 1.0 isoniazid Not assoc w R
gyrB 5752 c.513G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6406 c.1167C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6446 p.Ala403Ser missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Uncertain significance
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8285 c.984C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9143 c.1842T>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9217 p.Asp639Ala missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13197 p.Thr121Ser missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13228 c.330delG frameshift_variant 1.0 isoniazid Uncertain significance
Rv0010c 13441 p.Thr40Pro missense_variant 1.0 isoniazid Uncertain significance
Rv0010c 13460 c.99T>C synonymous_variant 1.0 isoniazid Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
delamanid Not assoc w R - Interim
Rv0565c 657578 c.-108T>C upstream_gene_variant 1.0 ethionamide
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 764049 p.Thr227Ser missense_variant 1.0 rifampicin
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800570 c.-239C>T upstream_gene_variant 1.0 linezolid
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1129c 1254582 c.-48A>G upstream_gene_variant 1.0 moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1129c 1254604 c.-70C>T upstream_gene_variant 1.0 moxifloxacin
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0 clofazimine Uncertain significance
delamanid Uncertain significance
embR 1417554 c.-207C>G upstream_gene_variant 1.0 ethambutol
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
rpsA 1834859 p.Ala440Thr missense_variant 1.0 pyrazinamide Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2062922 p.Ile603Val missense_variant 1.0 streptomycin Not assoc w R
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
ndh 2103173 c.-132delG upstream_gene_variant 1.0 ethionamide
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2155503 c.609C>T synonymous_variant 1.0 isoniazid Not assoc w R
katG 2155894 p.Val73Ala missense_variant 1.0 isoniazid Uncertain significance
katG 2156025 c.87C>A synonymous_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2168011 p.Ser868Arg missense_variant 1.0 pyrazinamide Uncertain significance
PPE35 2168255 c.2358G>A synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
PPE35 2168319 p.Thr765Ile missense_variant 1.0 pyrazinamide Uncertain significance
PPE35 2168814 c.1798dupA frameshift_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
eis 2715125 p.Thr70Ala missense_variant 1.0 amikacin Uncertain significance
kanamycin Uncertain significance
Rv2477c 2782927 c.1116A>G synonymous_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R - Interim
streptomycin Not assoc w R
levofloxacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
rifampicin Not assoc w R
amikacin Not assoc w R - Interim
Rv2681 2997325 p.Ala196Val missense_variant 1.0 capreomycin Uncertain significance
thyX 3067946 c.-1C>T upstream_gene_variant 1.0 para-aminosalicylic_acid
ald 3086728 c.-92C>T upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3087084 c.266delA frameshift_variant 1.0 cycloserine
Rv3083 3448783 p.Val94Ile missense_variant 1.0 ethionamide Uncertain significance
lpqB 3623372 c.1539G>C synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3623730 p.Ser394Leu missense_variant 0.99 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3624350 c.561G>T synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3624486 p.Asp142Gly missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3624593 c.318G>A synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3624710 c.201G>A synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
clpC1 4038403 c.2302T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
glpK 4138377 p.Val460Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
glpK 4139272 c.464_483delTCCTGGAAAATGTCGATGGA frameshift_variant 1.0 ethambutol Uncertain significance
moxifloxacin Uncertain significance
streptomycin Uncertain significance
levofloxacin Uncertain significance
rifampicin Uncertain significance
isoniazid Uncertain significance
embC 4239541 c.-322T>C upstream_gene_variant 1.0 ethambutol Uncertain significance
embC 4240671 p.Thr270Ile missense_variant 1.0 ethambutol Not assoc w R
embC 4241597 p.Met579Leu missense_variant 1.0 ethambutol Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embC 4242970 c.3108C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4244220 c.988C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4246551 p.Asn13Ser missense_variant 0.98 ethambutol Not assoc w R
embB 4246864 c.351C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4247646 p.Glu378Ala missense_variant 1.0 ethambutol Not assoc w R
aftB 4267858 p.Ile327Val missense_variant 1.0 ethambutol Not assoc w R
aftB 4268844 c.-8A>G upstream_gene_variant 1.0 ethambutol Uncertain significance
ubiA 4269351 c.483C>T synonymous_variant 1.0 ethambutol Not assoc w R
ubiA 4269387 p.Glu149Asp missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269606 c.228T>C synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R