TB-Profiler result

Run: SRR19315458

Summary

Run ID: SRR19315458

Sample name:

Date: 03-04-2023 21:27:30

Number of reads: 1972046

Percentage reads mapped: 99.74

Strain: lineage4.5

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7581 p.Asp94Tyr missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761127 p.Ser441Gln missense_variant 1.0 rifampicin
katG 2154955 c.1155_1156dupGG frameshift_variant 1.0 isoniazid, isoniazid
pncA 2289180 p.Val21Ala missense_variant 1.0 pyrazinamide
ahpC 2726139 c.-54C>T upstream_gene_variant 1.0 isoniazid
gid 4407796 p.Ser136* stop_gained 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
ccsA 620566 p.Asp226Asn missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
fabG1 1673380 c.-60C>G upstream_gene_variant 0.11
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289076 p.Asp56His missense_variant 1.0
ahpC 2726149 c.-44_-43insC upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4248548 p.Ala679Thr missense_variant 1.0
whiB6 4338595 c.-75_-74insA upstream_gene_variant 1.0
whiB6 4338602 c.-81A>T upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0