TB-Profiler result

Run: SRR19428518

Summary

Run ID: SRR19428518

Sample name:

Date: 03-04-2023 21:38:56

Number of reads: 706162

Percentage reads mapped: 99.59

Strain: lineage4;lineage3.1.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 0.76
lineage4 Euro-American LAM;T;S;X;H None 0.12
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 0.83
lineage3.1.1 East-African-Indian CAS1-Kili RD750 0.68
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8688 p.Ala463Ser missense_variant 0.29
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 0.84
rpoB 759746 c.-61C>T upstream_gene_variant 0.61
rpoC 762434 c.-936T>G upstream_gene_variant 0.65
rpoC 763031 c.-339T>C upstream_gene_variant 0.74
rpoC 764995 c.1626C>G synonymous_variant 0.12
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 0.81
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.4
Rv1258c 1406349 p.Ile331Ser missense_variant 0.13
Rv1258c 1406379 p.Val321Asp missense_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
fabG1 1673283 c.-157A>C upstream_gene_variant 0.13
inhA 1674821 p.Leu207Pro missense_variant 0.15
rpsA 1833419 c.-123T>C upstream_gene_variant 0.11
tlyA 1917777 c.-163A>G upstream_gene_variant 0.22
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2153895 c.2217G>A synonymous_variant 0.12
katG 2154724 p.Arg463Leu missense_variant 0.97
katG 2155557 c.555C>T synonymous_variant 0.15
PPE35 2167926 p.Leu896Ser missense_variant 0.91
PPE35 2167983 p.Gly877Asp missense_variant 0.12
PPE35 2170461 p.Gly51Glu missense_variant 0.6
Rv1979c 2222308 p.Asp286Gly missense_variant 0.19
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 0.68
pncA 2289365 c.-125delC upstream_gene_variant 0.84
kasA 2518132 c.18C>T synonymous_variant 0.12
eis 2714908 p.Val142Gly missense_variant 0.1
ahpC 2726051 c.-142G>A upstream_gene_variant 0.15
ahpC 2726105 c.-88G>A upstream_gene_variant 0.8
ribD 2987480 c.642G>C synonymous_variant 0.12
Rv2752c 3066280 c.-89C>T upstream_gene_variant 0.12
ald 3086788 c.-32T>C upstream_gene_variant 0.97
fbiD 3339253 p.Thr46Pro missense_variant 0.14
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 0.14
fbiB 3642098 c.564G>A synonymous_variant 0.27
clpC1 4040517 p.Val63Ala missense_variant 0.17
embC 4240172 p.Val104Met missense_variant 0.55
embC 4240671 p.Thr270Ile missense_variant 0.11
embC 4241042 p.Asn394Asp missense_variant 0.19
embC 4241562 p.Arg567His missense_variant 0.5
embC 4242075 p.Arg738Gln missense_variant 0.76
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243813 p.Arg194Gln missense_variant 0.21
embA 4243848 p.Val206Met missense_variant 0.21
embA 4245883 p.Gly884Asp missense_variant 0.13
embB 4249718 p.Thr1069Ser missense_variant 0.11
aftB 4267843 p.Asp332Tyr missense_variant 0.11
ubiA 4269387 p.Glu149Asp missense_variant 0.12
ethA 4326953 p.Asp174Gly missense_variant 0.54
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338603 c.-82C>T upstream_gene_variant 0.12
gid 4407588 c.615A>G synonymous_variant 0.78