TB-Profiler result

Run: SRR21736949
Summary

Run ID: SRR21736949

Sample name:

Date: 04-04-2023 03:24:38

Number of reads: 2360902

Percentage reads mapped: 99.66

Strain: lineage3.1.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 1.0
lineage3.1.2 East-African-Indian CAS;CAS2 RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6372 p.Thr378Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9315 c.2014C>T synonymous_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303928 p.Ala333Val missense_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.14
embR 1417330 c.18A>C synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834972 c.1431C>T synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168604 p.Pro670Leu missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878549 c.-42A>G upstream_gene_variant 0.11
rpoA 3878567 c.-60C>G upstream_gene_variant 0.22
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407861 c.342C>A synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0