TB-Profiler result

Run: SRR21747055
Summary

Run ID: SRR21747055

Sample name:

Date: 04-04-2023 03:29:24

Number of reads: 2257537

Percentage reads mapped: 99.64

Strain: lineage4.5

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
inhA 1674481 p.Ser94Ala missense_variant 1.0 isoniazid, ethionamide
pncA 2289049 c.192_193insA frameshift_variant 1.0 pyrazinamide, pyrazinamide
embB 4247730 p.Gly406Ala missense_variant 0.84 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoB 761311 c.1510_1515dupGGGTTC conservative_inframe_insertion 0.93
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.16
rrs 1471647 n.-199G>A upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1473906 n.249G>A non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
tlyA 1918406 p.Ser156Leu missense_variant 0.96
PPE35 2169119 c.1493dupT frameshift_variant 0.99
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407847 p.Ala119Asp missense_variant 0.9
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0