TB-Profiler result

Run: SRR6896446
Summary

Run ID: SRR6896446

Sample name:

Date: 04-04-2023 18:06:20

Number of reads: 107470

Percentage reads mapped: 99.61

Strain: lineage3

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8558 c.1257C>T synonymous_variant 0.29
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoB 761609 p.Met601Ile missense_variant 0.5
rpoC 762434 c.-936T>G upstream_gene_variant 0.71
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpS5 778805 p.Ser34Phe missense_variant 0.33
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304625 c.1695C>T synonymous_variant 0.29
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.67
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472879 n.1034T>G non_coding_transcript_exon_variant 0.17
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.15
rrl 1474736 n.1079C>A non_coding_transcript_exon_variant 0.25
rrl 1474976 n.1320delT non_coding_transcript_exon_variant 0.29
rrl 1475116 n.1459G>A non_coding_transcript_exon_variant 0.2
rrl 1476169 n.2512A>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2170461 p.Gly51Glu missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
kasA 2518656 p.Ala181Glu missense_variant 0.29
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
Rv2752c 3065477 p.Ala239Thr missense_variant 0.25
thyX 3067732 p.Val72Leu missense_variant 0.25
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
alr 3840546 p.Gly292Ala missense_variant 0.12
embC 4239972 p.Gly37Val missense_variant 1.0
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethR 4326955 c.-594G>A upstream_gene_variant 0.33
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0