TB-Profiler result

Run: SRR998851

Summary

Run ID: SRR998851

Sample name:

Date: 04-04-2023 23:39:01

Number of reads: 1131138

Percentage reads mapped: 92.69

Strain: lineage4.1

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Phe missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288832 p.His137Arg missense_variant 1.0 pyrazinamide
embB 4248003 p.Gln497Arg missense_variant 1.0 ethambutol
gid 4408100 c.102delG frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781421 c.-139C>A upstream_gene_variant 1.0
fbiC 1304610 c.1680C>T synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
inhA 1674102 c.-100C>A upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 0.96
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612051 p.Thr356Ser missense_variant 0.12
rpoA 3878641 c.-135delG upstream_gene_variant 0.22
ddn 3987264 c.425_452delGCACGATCCCGATCGTGGTTTGCGAACC frameshift_variant 0.11
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embA 4244283 c.1057_1060dupGGGC frameshift_variant 0.25
ubiA 4269313 p.Lys174Thr missense_variant 1.0
ethA 4327471 c.3G>T start_lost 1.0