TB-Profiler result

Run: DRR261072


Run ID: DRR261072

Sample name:

Date: 2024-03-25T20:11:02.487784

Number of reads: 1731591

Percentage reads mapped: 99.41

Median coverage: 120.0

Strain: lineage1.1.1.1


Drug-resistance: Sensitive

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage1.1 Indo-Oceanic RD239 1.0
lineage1 Indo-Oceanic RD239 1.0
lineage1.1.1 Indo-Oceanic RD239 1.0
lineage1.1.1.1 Indo-Oceanic RD239 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6112 p.Met291Ile missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8452 p.Ala384Val missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8731 p.Gly477Glu missense_variant 0.39 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9143 c.1842T>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13275 p.Tyr95Cys missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13298 p.Ile87Met missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13460 c.99T>C synonymous_variant 0.99 isoniazid Not assoc w R
Rv0010c 13482 p.Ala26Val missense_variant 1.0 isoniazid Not assoc w R
fgd1 490972 p.Arg64Ser missense_variant 1.0 clofazimine Uncertain significance
delamanid Uncertain significance
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
delamanid Not assoc w R - Interim
mshA 576394 c.1047G>A synonymous_variant 0.19 ethionamide
Rv0565c 657578 c.-108T>C upstream_gene_variant 1.0 ethionamide
nusG 734116 c.-138T>C upstream_gene_variant 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763884 p.Ala172Val missense_variant 0.99 rifampicin Not assoc w R
rpoC 763886 c.517C>A synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 765171 p.Pro601Leu missense_variant 0.99 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 0.99 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 777581 p.Tyr300* stop_gained 0.99 clofazimine Uncertain significance
bedaquiline Uncertain significance
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800357 c.-452C>A upstream_gene_variant 1.0 linezolid Not assoc w R
Rv1129c 1254543 c.-9T>G upstream_gene_variant 1.0 moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1258c 1406179 p.Val388Met missense_variant 0.58 streptomycin Uncertain significance
isoniazid Uncertain significance
pyrazinamide Uncertain significance
embR 1417019 p.Cys110Tyr missense_variant 1.0 ethambutol Not assoc w R
embR 1417554 c.-207C>G upstream_gene_variant 1.0 ethambutol
embR 1417793 c.-446C>T upstream_gene_variant 0.99 ethambutol
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
rrl 1474709 n.1052G>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rpsA 1834319 p.Val260Ile missense_variant 1.0 pyrazinamide Uncertain significance
tsnR 1853974 c.369C>T synonymous_variant 0.99 linezolid Not assoc w R
tsnR 1854045 p.Tyr147Cys missense_variant 1.0 linezolid Not assoc w R
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2062922 p.Ile603Val missense_variant 1.0 streptomycin Not assoc w R
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063106 c.1623G>A synonymous_variant 1.0 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R - Interim
amikacin Not assoc w R - Interim
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2156389 c.-278G>C upstream_gene_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2167983 p.Gly877Asp missense_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
ahpC 2726051 c.-142G>A upstream_gene_variant 1.0 isoniazid
Rv2680 2996003 c.-101_-50delGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN upstream_gene_variant 1.0 capreomycin
Rv2680 2996003 c.-101_-51delTGACCTCCGCCGGCGACGATGCAGAGCGCAGCGATGAGGAGGAGCGGCGCT upstream_gene_variant 0.48 capreomycin Uncertain significance
Rv2752c 3064632 c.1560C>T synonymous_variant 0.99 ethambutol Not assoc w R
moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3083 3448714 p.Asp71His missense_variant 0.99 ethionamide Uncertain significance
lpqB 3624486 p.Asp142Gly missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 0.99 bedaquiline Uncertain significance
rifampicin Not assoc w R
fbiA 3640349 c.-194A>C upstream_gene_variant 0.43 clofazimine
rpoA 3878630 c.-124delC upstream_gene_variant 1.0 rifampicin Not assoc w R
clpC1 4040517 p.Val63Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim
glpK 4138377 p.Val460Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
glpK 4139074 p.Leu228Val missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Uncertain significance
streptomycin Uncertain significance
levofloxacin Uncertain significance
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4240671 p.Thr270Ile missense_variant 1.0 ethambutol Not assoc w R
embC 4241042 p.Asn394Asp missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243848 p.Val206Met missense_variant 1.0 ethambutol Not assoc w R
embA 4244096 c.864C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4245969 p.Pro913Ser missense_variant 1.0 ethambutol Not assoc w R
embB 4247646 p.Glu378Ala missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269387 p.Glu149Asp missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269606 c.228T>C synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338242 p.Gln94Glu missense_variant 1.0 capreomycin Uncertain significance
amikacin Uncertain significance
kanamycin Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338603 c.-82C>T upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R
gid 4407873 c.330G>T synonymous_variant 1.0 streptomycin Not assoc w R