TB-Profiler result

Run: ERR11488917

Summary

Run ID: ERR11488917

Sample name:

Date: 2024-10-03T21:13:12.210811

Number of reads: 2617458

Percentage reads mapped: 99.8

Median coverage: 82.0

Strain: lineage4.3.4.2.1

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.3 Euro-American (LAM) None 1.0
lineage4 Euro-American None 1.0
lineage4.3.4.2.1 Euro-American (LAM) RD174 1.0
lineage4.3.4 Euro-American (LAM) RD174 1.0
lineage4.3.4.2 Euro-American (LAM) RD174 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ahpC c.-52C>T Uncertain significance Mutation from literature
ethambutol embA c.-16C>T Uncertain significance Mutation from literature
embB p.Met306Leu Assoc w R
pyrazinamide pncA c.419delG Assoc w R
streptomycin rpsL p.Lys43Arg Assoc w R
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin rrs n.1401A>G Assoc w R
capreomycin rrs n.1401A>G Assoc w R
kanamycin rrs n.1401A>G Assoc w R
cycloserine
ethionamide ethA c.32delG Assoc w R
clofazimine mmpR5 p.Leu32Ser Assoc w R - Interim Can only confer resistance if genetically linked to a functional MmpL5
c.144dupC Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
c.492_493dupCG Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
para-aminosalicylic_acid
delamanid
bedaquiline mmpR5 p.Leu32Ser Assoc w R - Interim Includes data from one site that only submitted resistant strains, which may have inflated the PPV. Can only confer resistance if genetically linked to a functional MmpL5
c.144dupC Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
c.492_493dupCG Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
mmpR5 779084 p.Leu32Ser missense_variant 0.35 bedaquiline Assoc w R - Interim Includes data from one site that only submitted resistant strains, which may have inflated the PPV. Can only confer resistance if genetically linked to a functional MmpL5
clofazimine Assoc w R - Interim Can only confer resistance if genetically linked to a functional MmpL5
mmpR5 779130 c.144dupC frameshift_variant 0.21 bedaquiline Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
clofazimine Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
mmpR5 779480 c.492_493dupCG frameshift_variant 0.16 bedaquiline Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
clofazimine Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
rrs 1473246 n.1401A>G non_coding_transcript_exon_variant 1.0 amikacin Assoc w R
capreomycin Assoc w R
kanamycin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2288822 c.419delG frameshift_variant 1.0 pyrazinamide Assoc w R
ahpC 2726141 c.-52C>T upstream_gene_variant 1.0 isoniazid Uncertain significance Mutation from literature
embA 4243217 c.-16C>T upstream_gene_variant 1.0 ethambutol Uncertain significance Mutation from literature
embB 4247429 p.Met306Leu missense_variant 1.0 ethambutol Assoc w R
ethA 4327441 c.32delG frameshift_variant 1.0 ethionamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6140 p.Val301Leu missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8795 c.1494C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
rpoC 764703 p.Lys445Arg missense_variant 1.0 rifampicin Uncertain significance
rpoC 764995 c.1626C>G synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
mmpS5 779609 c.-704C>T upstream_gene_variant 1.0 bedaquiline
clofazimine
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 kanamycin
capreomycin
streptomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
pncA 2289909 c.-668G>A upstream_gene_variant 1.0 pyrazinamide
thyA 3073868 p.Thr202Ala missense_variant 1.0 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0 pyrazinamide Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 rifampicin Not assoc w R
bedaquiline Uncertain significance
alr 3840719 c.702A>G synonymous_variant 1.0 cycloserine
clpC1 4038287 c.2418C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243708 c.477_497dupCGGGACCCTGCCGCCGGAGAA disruptive_inframe_insertion 1.0 ethambutol
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 kanamycin
capreomycin
amikacin
gid 4408156 p.Leu16Arg missense_variant 1.0 streptomycin Not assoc w R