TB-Profiler result

Run: ERR3256232

Summary

Run ID: ERR3256232

Sample name:

Date: 2024-04-15T23:50:28.720321

Number of reads: 2846738

Percentage reads mapped: 99.25

Median coverage: 143.0

Strain: lineage1.2.1.2.1

Spoligotype:

Drug-resistance: Other


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage1.2.1.2 Indo-Oceanic RD239 1.0
lineage1 Indo-Oceanic RD239 1.0
lineage1.2.1.2.1 Indo-Oceanic RD239 1.0
lineage1.2.1 Indo-Oceanic RD239 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Assoc w R - Interim
c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT Assoc w R - Interim
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 delamanid Assoc w R - Interim
pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.31 delamanid Assoc w R - Interim
pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
dnaA 1302 c.1302C>A synonymous_variant 1.0 isoniazid Not assoc w R
gyrB 6112 p.Met291Ile missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8452 p.Ala384Val missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9143 c.1842T>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9260 c.1959G>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13175 c.384T>C synonymous_variant 1.0 isoniazid Not assoc w R
Rv0010c 13298 p.Ile87Met missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13460 c.99T>C synonymous_variant 1.0 isoniazid Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
mshA 575368 c.21T>C synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R
Rv0565c 657578 c.-108T>C upstream_gene_variant 1.0 ethionamide
nusG 734116 c.-138T>C upstream_gene_variant 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763531 c.162G>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763884 p.Ala172Val missense_variant 1.0 rifampicin Not assoc w R
rpoC 763886 c.517C>A synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800357 c.-452C>A upstream_gene_variant 1.0 linezolid Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1258c 1406312 c.1029T>C synonymous_variant 1.0 streptomycin Not assoc w R
isoniazid Not assoc w R
pyrazinamide Not assoc w R
embR 1417019 p.Cys110Tyr missense_variant 1.0 ethambutol Not assoc w R
embR 1417554 c.-207C>G upstream_gene_variant 1.0 ethambutol
embR 1417793 c.-446C>T upstream_gene_variant 1.0 ethambutol
atpE 1460907 c.-138T>C upstream_gene_variant 1.0 bedaquiline
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrl 1474639 n.982G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
inhA 1674162 c.-40C>T upstream_gene_variant 1.0 ethionamide Uncertain significance
isoniazid Not assoc w R
tsnR 1853974 c.369C>T synonymous_variant 0.99 linezolid Not assoc w R
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2062922 p.Ile603Val missense_variant 1.0 streptomycin Not assoc w R
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
kasA 2519048 p.Gly312Ser missense_variant 1.0 isoniazid
ahpC 2726051 c.-142G>A upstream_gene_variant 1.0 isoniazid
Rv2680 2996003 c.-101_-50delGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN upstream_gene_variant 1.0 capreomycin
Rv2680 2996003 c.-101_-51delTGACCTCCGCCGGCGACGATGCAGAGCGCAGCGATGAGGAGGAGCGGCGCT upstream_gene_variant 0.28 capreomycin Uncertain significance
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3086823 p.Arg2Cys missense_variant 0.99 cycloserine
fbiD 3339417 c.300A>G synonymous_variant 1.0 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
Rv3083 3448714 p.Asp71His missense_variant 1.0 ethionamide Uncertain significance
whiB7 3568488 c.191delG frameshift_variant 1.0 streptomycin Uncertain significance
amikacin Uncertain significance
kanamycin Uncertain significance
lpqB 3624486 p.Asp142Gly missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
fbiA 3640557 c.15T>C synonymous_variant 1.0 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
clpC1 4040517 p.Val63Ala missense_variant 0.99 pyrazinamide Not assoc w R - Interim
glpK 4138377 p.Val460Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4240671 p.Thr270Ile missense_variant 1.0 ethambutol Not assoc w R
embC 4241042 p.Asn394Asp missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243580 c.348G>A synonymous_variant 1.0 ethambutol Not assoc w R
embA 4244420 c.1188G>C synonymous_variant 1.0 ethambutol Not assoc w R
embA 4245969 p.Pro913Ser missense_variant 1.0 ethambutol Not assoc w R
embB 4247578 c.1065G>A synonymous_variant 1.0 ethambutol Not assoc w R
embB 4247646 p.Glu378Ala missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269387 p.Glu149Asp missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269606 c.228T>C synonymous_variant 1.0 ethambutol Not assoc w R
ubiA 4269864 c.-32delG upstream_gene_variant 1.0 ethambutol Not assoc w R
whiB6 4338361 p.Arg54Gln missense_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338603 c.-82C>T upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R
gid 4407873 c.330G>T synonymous_variant 1.0 streptomycin Not assoc w R