TB-Profiler result

Run: ERR4407446

Summary

Run ID: ERR4407446

Sample name:

Date: 01-04-2023 05:44:23

Number of reads: 484949

Percentage reads mapped: 81.47

Strain: lineage3

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9596 c.2295G>T synonymous_variant 1.0
gyrA 9777 p.Asn826Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 575470 c.123A>G synonymous_variant 0.11
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoB 762636 p.Lys944Glu missense_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 764181 p.Asp271Gly missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpR5 778313 c.-677G>T upstream_gene_variant 0.12
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474802 n.1145T>C non_coding_transcript_exon_variant 0.1
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.25
PPE35 2170769 c.-157C>T upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
eis 2715432 c.-100C>T upstream_gene_variant 1.0
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ribD 2987238 p.Thr134Ala missense_variant 0.11
thyX 3067617 p.Pro110Leu missense_variant 0.11
thyA 3074379 c.93C>T synonymous_variant 0.11
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087578 c.759A>G synonymous_variant 0.1
fbiD 3339273 c.156T>G synonymous_variant 0.4
Rv3083 3448555 p.Gly18Arg missense_variant 0.14
Rv3083 3448874 p.Ala124Val missense_variant 0.12
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474276 c.270C>A synonymous_variant 0.12
fbiB 3642457 p.Arg308Gln missense_variant 0.12
clpC1 4038745 p.Thr654Ala missense_variant 0.1
panD 4044280 c.1delA frameshift_variant&start_lost 0.13
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242756 p.Ile965Asn missense_variant 0.1
embA 4243657 p.Trp142* stop_gained 0.12
embA 4244184 p.Ser318Arg missense_variant 0.1
embB 4246151 c.-363A>G upstream_gene_variant 0.11
embB 4247890 c.1380_1420delCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCG frameshift_variant 0.11
embB 4247933 p.Gly474Ser missense_variant 0.1
embB 4247936 c.1424_1437delCGTTGCCGTTGGTG frameshift_variant 0.11
embB 4247954 p.Pro481Ala missense_variant 0.11
embB 4247957 c.1445_1457delTGCTGGCCGCCGG frameshift_variant 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0