TB-Profiler result

Run: ERR4812245

Summary

Run ID: ERR4812245

Sample name:

Date: 01-04-2023 11:57:17

Number of reads: 5118942

Percentage reads mapped: 99.76

Strain: lineage4.3.2

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.2 Euro-American (LAM) LAM3 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761139 p.His445Asp missense_variant 1.0 rifampicin
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
katG 2153909 p.Asp735Asn missense_variant 1.0 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472337 n.492C>T non_coding_transcript_exon_variant 1.0
rpsA 1834888 c.1347G>A synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878051 p.Arg153Trp missense_variant 1.0
rpoA 3878580 c.-113_-74delCAACCCAACCCTCGGGGGGCGCCGCCCCCCGAGTACCCCC upstream_gene_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247028 p.Leu172Arg missense_variant 0.22
embB 4247033 p.Ser174Arg missense_variant 0.26
whiB6 4338365 p.Cys53Gly missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408048 p.Cys52Tyr missense_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0