TB-Profiler result

Run: ERR9992982


Run ID: ERR9992982

Sample name:

Date: 02-04-2023 13:58:15

Number of reads: 3877746

Percentage reads mapped: 99.63

Strain: lineage2.2.1

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage2 East-Asian Beijing RD105 1.0
lineage2.2 East-Asian (Beijing) Beijing-RD207 RD105;RD207 1.0
lineage2.2.1 East-Asian (Beijing) Beijing-RD181 RD105;RD207;RD181 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rplC 801268 p.Cys154Arg missense_variant 1.0 linezolid
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
inhA 1674782 p.Ile194Thr missense_variant 1.0 isoniazid, ethionamide
pncA 2288801 c.440delT frameshift_variant 1.0 pyrazinamide
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
ethR 4327831 p.Ala95Thr missense_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 575907 p.Ala187Val missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.29
ccsA 620625 p.Ile245Met missense_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 763555 c.186C>T synonymous_variant 1.0
rpoC 766707 p.Glu1113Gly missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 776182 p.Asp767Asn missense_variant 1.0
mmpS5 778979 c.-74G>T upstream_gene_variant 1.0
mmpR5 779056 c.68_105delTGGGCGGCTATTTCGAGTCCAGGAGTTTGACTCGGTTG frameshift_variant 0.57
mmpR5 779354 p.Leu122Pro missense_variant 0.35
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834177 c.636A>C synonymous_variant 0.99
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243460 c.228C>T synonymous_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.2
aftB 4267647 p.Asp397Gly missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407927 p.Glu92Asp missense_variant 1.0