TB-Profiler result

Run: SRR10251195

Summary

Run ID: SRR10251195

Sample name:

Date: 2024-04-14T10:30:57.344494

Number of reads: 1352274

Percentage reads mapped: 99.69

Median coverage: 61.0

Strain: La3

Spoligotype:

Drug-resistance: Other


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
La3 M.orygis None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide ethA c.430_432delGACinsAT Assoc w R
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
ethA 4327042 c.430_432delGACinsAT frameshift_variant&synonymous_variant 1.0 ethionamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 4966 c.-274C>T upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 5516 p.Ile93Val missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrB 6109 c.870G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6446 p.Ala403Ser missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Uncertain significance
gyrB 6717 p.Ile493Thr missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8930 c.1629C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9143 c.1842T>C synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13315 p.Ser82Pro missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13441 p.Thr40Ala missense_variant 1.0 isoniazid Not assoc w R
Rv0010c 13460 c.99T>C synonymous_variant 1.0 isoniazid Not assoc w R
fgd1 490661 c.-122_-121insGCGAGC upstream_gene_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
fgd1 491749 p.Leu323Phe missense_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
Rv0565c 657578 c.-108T>C upstream_gene_variant 1.0 ethionamide
rpoB 762352 c.2557_2562dupGACGAG conservative_inframe_insertion 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 778086 c.394dupG frameshift_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
sigE 1364345 c.-68A>G upstream_gene_variant 1.0 pyrazinamide
embR 1417554 c.-207C>G upstream_gene_variant 1.0 ethambutol
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrl 1475539 n.1882A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476664 n.3007T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
inhA 1673680 c.-522C>G upstream_gene_variant 1.0 ethionamide Uncertain significance
isoniazid Not assoc w R
rpsA 1834363 c.822G>A synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
tsnR 1854300 p.Leu232Pro missense_variant 0.98 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2062922 p.Ile603Val missense_variant 1.0 streptomycin Not assoc w R
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2154707 p.Val469Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2155503 c.609C>T synonymous_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2169279 c.1312_1333delAACAATGGTGTCTTTTACCGTG frameshift_variant 1.0 pyrazinamide Uncertain significance
PPE35 2170565 c.48C>T synonymous_variant 0.98 pyrazinamide
PPE35 2170669 c.-57G>A upstream_gene_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2289978 c.-737T>G upstream_gene_variant 1.0 pyrazinamide
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
eis 2715435 c.-103C>T upstream_gene_variant 1.0 amikacin
kanamycin
ahpC 2726378 c.186T>A synonymous_variant 1.0 isoniazid Not assoc w R
folC 2746391 p.Val403Ala missense_variant 1.0 para-aminosalicylic_acid
Rv2752c 3067009 c.-818A>G upstream_gene_variant 1.0 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
thyX 3067812 p.Gln45Arg missense_variant 1.0 para-aminosalicylic_acid
thyA 3074494 c.-81_-24delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG upstream_gene_variant 1.0 para-aminosalicylic_acid
thyA 3074494 c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC upstream_gene_variant 1.0 para-aminosalicylic_acid
ald 3086728 c.-92C>T upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3087084 c.266delA frameshift_variant 1.0 cycloserine
Rv3083 3448783 p.Val94Ile missense_variant 1.0 ethionamide Uncertain significance
Rv3236c 3612694 c.423T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
Rv3236c 3613600 c.-484G>A upstream_gene_variant 1.0 pyrazinamide
lpqB 3624350 c.561G>T synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
lpqB 3624486 p.Asp142Gly missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3624593 c.318G>A synonymous_variant 1.0 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
fbiB 3641584 p.Val17Ala missense_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
fbiB 3642776 c.1242G>A synonymous_variant 1.0 clofazimine
pretomanid
delamanid
rpoA 3878630 c.-124delC upstream_gene_variant 1.0 rifampicin Not assoc w R
clpC1 4039853 c.852G>A synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4040095 p.Leu204Phe missense_variant 0.45 pyrazinamide
clpC1 4040945 c.-241G>A upstream_gene_variant 1.0 pyrazinamide
glpK 4138377 p.Val460Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4239276 c.-587_-586insTGGCCGCCGCCATCGGGT upstream_gene_variant 1.0 ethambutol Uncertain significance
embC 4240671 p.Thr270Ile missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4244154 p.Thr308Ala missense_variant 1.0 ethambutol Not assoc w R
embA 4244220 c.988C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4246864 c.351C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4247646 p.Glu378Ala missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269351 c.483C>T synonymous_variant 1.0 ethambutol Not assoc w R
ubiA 4269387 p.Glu149Asp missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269606 c.228T>C synonymous_variant 1.0 ethambutol Not assoc w R
ethA 4328211 c.-738A>G upstream_gene_variant 1.0 ethionamide
whiB6 4338269 p.Gly85Ser missense_variant 1.0 capreomycin Uncertain significance
amikacin Uncertain significance
kanamycin Uncertain significance
whiB6 4338516 c.5_6insCTTCCCGCCCCGACAGCCTGGGCCGACCCGTCGGTTAATGCG disruptive_inframe_insertion 0.96 capreomycin
amikacin
kanamycin
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
whiB6 4338842 c.-321C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R