TB-Profiler result

Run: SRR10525364

Summary

Run ID: SRR10525364

Sample name:

Date: 02-04-2023 18:33:14

Number of reads: 2624789

Percentage reads mapped: 99.41

Strain: lineage4

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rrs 1473246 n.1401A>G non_coding_transcript_exon_variant 1.0 kanamycin, capreomycin, aminoglycosides, amikacin
inhA 1674048 c.-154G>A upstream_gene_variant 1.0 isoniazid, ethionamide
inhA 1674263 p.Ile21Thr missense_variant 1.0 isoniazid, ethionamide
pncA 2288839 p.Thr135Pro missense_variant 1.0 pyrazinamide
embB 4247730 p.Gly406Ala missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.26
ccsA 620619 c.729G>A synonymous_variant 1.0
rpoB 761314 p.Phe503Ser missense_variant 1.0
rpoB 761423 p.Asn539Lys missense_variant 1.0
rpoB 762819 p.Phe1005Val missense_variant 1.0
rpoC 763507 c.138G>A synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 778090 p.Gly131Arg missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
embR 1416966 p.Ala128Pro missense_variant 1.0
rrs 1471656 n.-190G>T upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474074 n.417C>T non_coding_transcript_exon_variant 1.0
fabG1 1673380 c.-60C>G upstream_gene_variant 0.16
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086838 p.Thr7Ala missense_variant 1.0
fbiD 3339734 p.Ala206Gly missense_variant 0.35
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
rpoA 3878613 c.-106A>C upstream_gene_variant 0.22
ddn 3987293 p.Glu150Asp missense_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246544 p.Thr11Pro missense_variant 0.26
embB 4246548 p.Pro12Gln missense_variant 0.16
embB 4246555 c.42G>C synonymous_variant 0.21
embB 4246556 p.Ala15Pro missense_variant 0.21
embB 4246584 p.Arg24Pro missense_variant 0.27
ethA 4327310 p.Ser55Cys missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408134 c.32_68delTCTTCGGACCGCGGCTTGGCCTTGCTCGGCGGTACGC frameshift_variant 1.0