TB-Profiler result

Run: SRR11294521

Summary

Run ID: SRR11294521

Sample name:

Date: 02-04-2023 20:45:23

Number of reads: 1573251

Percentage reads mapped: 98.73

Strain: La1.7.1

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
La1 M.bovis None None 1.0
La1.7 M.bovis None None 1.0
La1.7.1 M.bovis None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
pncA 2289073 p.His57Asp missense_variant 1.0 pyrazinamide
gid 4408065 c.137dupA frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5752 c.513G>A synonymous_variant 0.97
gyrA 6406 c.-896C>T upstream_gene_variant 1.0
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8285 c.984C>T synonymous_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9217 p.Asp639Ala missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
ccsA 620830 p.Thr314Ala missense_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.26
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834859 p.Ala440Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2103173 c.-132delG upstream_gene_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2154984 c.1128G>A synonymous_variant 0.98
katG 2155503 c.609C>T synonymous_variant 1.0
katG 2156025 c.87C>A synonymous_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168011 p.Ser868Arg missense_variant 1.0
PPE35 2168319 p.Thr765Ile missense_variant 1.0
PPE35 2168814 c.1798dupA frameshift_variant 1.0
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2222942 p.Asn75His missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289020 c.222C>T synonymous_variant 0.99
kasA 2518132 c.18C>T synonymous_variant 1.0
ahpC 2726104 c.-89T>G upstream_gene_variant 1.0
pepQ 2859693 c.726C>T synonymous_variant 1.0
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
Rv3083 3448783 p.Val94Ile missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474427 p.Val141Ile missense_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
fbiB 3642478 p.Asp315Ala missense_variant 1.0
rpoA 3878214 c.294C>A synonymous_variant 1.0
clpC1 4038403 c.2302T>C synonymous_variant 1.0
embC 4240080 p.Pro73Gln missense_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4242970 c.-263C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embB 4246551 p.Asn13Ser missense_variant 0.98
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
aftB 4267858 p.Ile327Val missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0