TB-Profiler result

Run: SRR15316368


Run ID: SRR15316368

Sample name:

Date: 2024-03-27T01:57:11.579697

Number of reads: 9694595

Percentage reads mapped: 97.77

Median coverage: 290.0

Strain: lineage2.2.1


Drug-resistance: Pre-XDR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage2 East-Asian RD105 1.0
lineage2.2.1 East-Asian (Beijing) RD105;RD207;RD181 1.0
lineage2.2 East-Asian (Beijing) RD105;RD207 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
ethambutol embB p.Met306Ile Assoc w R
pyrazinamide pncA p.Asp12Gly Assoc w R
moxifloxacin gyrA p.Asp94Gly Assoc w R High-level resistance
levofloxacin gyrA p.Asp94Gly Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7582 p.Asp94Gly missense_variant 1.0 moxifloxacin Assoc w R High-level resistance
levofloxacin Assoc w R
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
pncA 2289207 p.Asp12Gly missense_variant 1.0 pyrazinamide Assoc w R
embB 4247431 p.Met306Ile missense_variant 1.0 ethambutol Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
delamanid Not assoc w R - Interim
mshA 575828 p.Val161Ile missense_variant 1.0 ethionamide
mshA 575907 p.Ala187Val missense_variant 1.0 ethionamide Not assoc w R
isoniazid Not assoc w R
ccsA 620625 p.Ile245Met missense_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Uncertain significance
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
Rv0565c 657142 p.Arg110His missense_variant 1.0 ethionamide Uncertain significance
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 766488 p.Pro1040Arg missense_variant 1.0 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776182 p.Asp767Asn missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0 clofazimine
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0 streptomycin Uncertain significance
isoniazid Uncertain significance
pyrazinamide Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
rpsA 1833958 p.Ile139Met missense_variant 0.97 pyrazinamide
rpsA 1834177 c.636A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
ahpC 2726121 c.-72C>T upstream_gene_variant 1.0 isoniazid Uncertain significance
Rv2752c 3065449 c.719_742delCCAACGTGGATCGGGTACAGCAGA disruptive_inframe_deletion 1.0 ethambutol
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrB 3626562 p.Pro18Ser missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrB 3627541 c.-928A>G upstream_gene_variant 0.98 bedaquiline
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243460 c.228C>T synonymous_variant 1.0 ethambutol Not assoc w R
aftB 4267647 p.Asp397Gly missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269308 p.Phe176Leu missense_variant 1.0 ethambutol Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R
gid 4407927 p.Glu92Asp missense_variant 1.0 streptomycin Not assoc w R