TB-Profiler result

Run: SRR16089912

Summary

Run ID: SRR16089912

Sample name:

Date: 03-04-2023 16:15:19

Number of reads: 2788126

Percentage reads mapped: 98.61

Strain: lineage4.8

Drug-resistance: HR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
folC 2747480 p.Glu40Gly missense_variant 1.0 para-aminosalicylic_acid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 8151 p.Ile284Val missense_variant 1.0
mshA 575891 p.Ala182Thr missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472753 n.908A>C non_coding_transcript_exon_variant 0.97
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2155784 p.Ala110Thr missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 0.99
embB 4247595 p.Cys361Ser missense_variant 1.0
aftB 4268040 p.Leu266Pro missense_variant 1.0
whiB6 4338286 c.235delG frameshift_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0