TB-Profiler result

Run: SRR19428532
Summary

Run ID: SRR19428532

Sample name:

Date: 03-04-2023 21:39:31

Number of reads: 2059679

Percentage reads mapped: 99.61

Strain: lineage4;lineage3.1.1

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 0.77
lineage4 Euro-American LAM;T;S;X;H None 0.08
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 0.74
lineage3.1.1 East-African-Indian CAS1-Kili RD750 0.78
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gid 4407851 c.351delG frameshift_variant 0.67 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6112 p.Met291Ile missense_variant 0.11
gyrA 7362 p.Glu21Gln missense_variant 0.98
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 0.88
ccsA 620625 p.Ile245Met missense_variant 0.1
rpoB 759746 c.-61C>T upstream_gene_variant 0.79
rpoB 761489 c.1683G>A synonymous_variant 0.15
rpoC 762434 c.-936T>G upstream_gene_variant 0.87
rpoC 763031 c.-339T>C upstream_gene_variant 0.94
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 0.94
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.18
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 0.93
PPE35 2167926 p.Leu896Ser missense_variant 0.96
PPE35 2170461 p.Gly51Glu missense_variant 0.84
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 0.79
pncA 2289365 c.-125delC upstream_gene_variant 0.79
ahpC 2726105 c.-88G>A upstream_gene_variant 0.8
ald 3086788 c.-32T>C upstream_gene_variant 0.97
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474597 c.591C>A synonymous_variant 0.15
clpC1 4040335 c.370C>T synonymous_variant 0.69
embC 4240172 p.Val104Met missense_variant 0.11
embC 4241562 p.Arg567His missense_variant 0.78
embC 4242075 p.Arg738Gln missense_variant 0.82
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243532 c.300C>A synonymous_variant 0.12
embA 4245969 p.Pro913Ser missense_variant 0.12
embA 4246275 p.Ala1015Thr missense_variant 0.12
aftB 4267300 p.Pro513Ser missense_variant 0.74
ubiA 4269387 p.Glu149Asp missense_variant 0.12
aftB 4269606 c.-770T>C upstream_gene_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338603 c.-82C>T upstream_gene_variant 0.11
gid 4407588 c.615A>G synonymous_variant 0.91
gid 4408124 p.Ala27Pro missense_variant 0.14
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0