TB-Profiler result

Run: SRR25827630

Summary

Run ID: SRR25827630

Sample name:

Date: 02-02-2024 12:23:25

Number of reads: 7120086

Percentage reads mapped: 98.98

Strain: lineage1.1.2

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin
Isoniazid
Ethambutol
Pyrazinamide
Streptomycin
Fluoroquinolones
Moxifloxacin
Ofloxacin
Levofloxacin
Ciprofloxacin
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage1 Indo-Oceanic EAI RD239 0.99
lineage1.1 Indo-Oceanic EAI3;EAI4;EAI5;EAI6 RD239 0.99
lineage1.1.2 Indo-Oceanic EAI3;EAI5 RD239 0.76
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6112 p.Met291Ile missense_variant 1.0
gyrB 6124 c.885C>T synonymous_variant 0.74
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8452 p.Ala384Val missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 576675 p.Arg443His missense_variant 0.23
rpoB 759886 p.Pro27His missense_variant 0.21
rpoB 760490 c.684C>T synonymous_variant 0.72
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 763884 p.Ala172Val missense_variant 0.98
rpoC 763886 c.517C>A synonymous_variant 0.98
rpoC 765171 p.Pro601Leu missense_variant 1.0
rpoC 765230 p.Ala621Thr missense_variant 0.23
rpoC 767308 c.3939C>T synonymous_variant 0.29
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 776395 p.Phe696Leu missense_variant 0.74
mmpL5 778099 p.Asp128Asn missense_variant 0.22
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1407190 c.123_150delTGGGCAGGCCTCGATCGTGGCCAGTGCG frameshift_variant 0.18
embR 1416574 c.774A>G synonymous_variant 0.28
embR 1417019 p.Cys110Tyr missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 0.99
PPE35 2167983 p.Gly877Asp missense_variant 0.99
PPE35 2170785 c.-173T>C upstream_gene_variant 0.68
Rv1979c 2222308 p.Asp286Gly missense_variant 0.99
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 0.99
kasA 2518173 p.Thr20Ile missense_variant 0.71
eis 2715016 p.Arg106His missense_variant 0.7
ahpC 2726051 c.-142G>A upstream_gene_variant 1.0
Rv2752c 3064632 c.1560C>T synonymous_variant 1.0
Rv2752c 3065419 p.Arg258Leu missense_variant 0.7
ald 3086767 c.-53A>T upstream_gene_variant 0.24
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448714 p.Asp71His missense_variant 0.99
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474597 c.591C>A synonymous_variant 0.99
fprA 3475159 p.Asn385Asp missense_variant 0.99
Rv3236c 3613309 c.-193G>A upstream_gene_variant 0.72
alr 3840948 p.Val158Ala missense_variant 0.27
rpoA 3878575 c.-68C>A upstream_gene_variant 0.73
clpC1 4040517 p.Val63Ala missense_variant 0.99
embC 4240671 p.Thr270Ile missense_variant 1.0
embC 4241042 p.Asn394Asp missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4243056 p.Pro1065Leu missense_variant 0.23
embA 4243848 p.Val206Met missense_variant 1.0
embA 4245314 c.2082G>C synonymous_variant 0.26
embA 4245969 p.Pro913Ser missense_variant 1.0
embB 4247028 p.Leu172Arg missense_variant 0.14
embB 4247646 p.Glu378Ala missense_variant 0.99
ubiA 4269387 p.Glu149Asp missense_variant 0.99
ubiA 4269523 p.Thr104Ile missense_variant 0.76
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
whiB6 4338386 p.Asp46His missense_variant 0.81
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338603 c.-82C>T upstream_gene_variant 0.99
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407780 c.423G>A synonymous_variant 0.24
gid 4407873 c.330G>T synonymous_variant 0.99
gid 4408252 c.-50A>G upstream_gene_variant 0.26
gid 4408338 c.-136A>G upstream_gene_variant 0.3