TB-Profiler result

Run: SRR6824480

Summary

Run ID: SRR6824480

Sample name:

Date: 04-04-2023 16:40:01

Number of reads: 7823464

Percentage reads mapped: 99.15

Strain: lineage4.2.2

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.2 Euro-American H;T;LAM None 1.0
lineage4.2.2 Euro-American (Ural) T;LAM7-TUR None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2289207 p.Asp12Gly missense_variant 1.0 pyrazinamide
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
gid 4408087 c.115delC frameshift_variant 0.99 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576077 c.730C>T synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpR5 779268 p.Phe93Leu missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0
thyA 3074494 c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC upstream_gene_variant 1.0
ald 3086742 c.-78A>C upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612469 c.648A>G synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4327128 p.Trp116Arg missense_variant 0.9
ethA 4327480 c.-7T>G upstream_gene_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0