TB-Profiler result

Run: ERR2510590

Summary

Run ID: ERR2510590

Sample name:

Date: 2024-04-15T13:41:38.471361

Number of reads: 1414260

Percentage reads mapped: 99.67

Median coverage: 46.0

Strain: lineage3.1

Spoligotype:

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage3 East-African-Indian RD750 1.0
lineage3.1 East-African-Indian RD750 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG c.238_260delATCGAGGAAGTGATGACCACCTC Assoc w R High-level resistance
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin gyrA p.Ser91Pro Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ofloxacin
levofloxacin gyrA p.Ser91Pro Assoc w R
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7572 p.Ser91Pro missense_variant 1.0 levofloxacin Assoc w R
moxifloxacin Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
katG 2155851 c.238_260delATCGAGGAAGTGATGACCACCTC frameshift_variant 1.0 isoniazid Assoc w R High-level resistance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
rpoB 759746 c.-61C>T upstream_gene_variant 1.0 rifampicin Not assoc w R
rpoB 760281 p.Thr159Pro missense_variant 1.0 rifampicin Uncertain significance
rpoB 762434 c.2628T>G synonymous_variant 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 765860 p.Phe831Leu missense_variant 1.0 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800899 p.Ala31Thr missense_variant 1.0 linezolid Uncertain significance
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrl 1476542 n.2885T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rpsA 1834607 p.Arg356Cys missense_variant 1.0 pyrazinamide Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
tlyA 1918532 p.Val198Gly missense_variant 1.0 capreomycin Uncertain significance
bacA 2064259 p.Leu157Pro missense_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin
amikacin Uncertain significance
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2289047 c.195C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
pncA 2289365 c.-125delC upstream_gene_variant 1.0 pyrazinamide
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0 isoniazid Not assoc w R
Rv2477c 2782498 c.1545C>T synonymous_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
kanamycin Not assoc w R
rifampicin Not assoc w R
amikacin Not assoc w R
Rv2681 2997830 c.1092G>A synonymous_variant 1.0 capreomycin
thyX 3067330 p.Val206Met missense_variant 1.0 para-aminosalicylic_acid
thyA 3074305 p.Ala56Val missense_variant 1.0 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
panD 4044872 c.-591C>T upstream_gene_variant 1.0 pyrazinamide
glpK 4138622 c.1134C>T synonymous_variant 1.0 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4242075 p.Arg738Gln missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4245346 p.Met705Thr missense_variant 1.0 ethambutol Uncertain significance
embB 4247468 p.Tyr319Asp missense_variant 0.99 ethambutol Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R