TB-Profiler result

Run: ERR351884

Summary

Run ID: ERR351884

Sample name:

Date: 01-04-2023 02:34:45

Number of reads: 4538393

Percentage reads mapped: 99.59

Strain: La3

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
La3 M.orygis None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5516 p.Ile93Val missense_variant 1.0
gyrB 6109 c.870G>A synonymous_variant 0.99
gyrB 6446 p.Ala403Ser missense_variant 0.99
gyrB 6717 p.Ile493Thr missense_variant 0.99
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8930 c.1629C>T synonymous_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.99
fgd1 490661 c.-122_-121insGCGAGC upstream_gene_variant 0.93
fgd1 491742 c.960T>C synonymous_variant 1.0
fgd1 491749 p.Leu323Phe missense_variant 1.0
rpoB 762352 c.2557_2562dupGACGAG conservative_inframe_insertion 0.97
rpoC 763031 c.-339T>C upstream_gene_variant 0.99
mmpL5 775639 p.Ile948Val missense_variant 0.98
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 778086 c.394dupG frameshift_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 0.99
fbiC 1302899 c.-32A>G upstream_gene_variant 0.99
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475539 n.1882A>G non_coding_transcript_exon_variant 0.98
rrl 1476664 n.3007T>G non_coding_transcript_exon_variant 1.0
inhA 1673680 c.-522C>G upstream_gene_variant 0.99
rpsA 1834363 c.822G>A synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154707 p.Val469Leu missense_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 0.99
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2169279 c.1312_1333delAACAATGGTGTCTTTTACCGTG frameshift_variant 1.0
PPE35 2170669 c.-57G>A upstream_gene_variant 0.99
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289978 c.-737T>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
ahpC 2726378 c.186T>A synonymous_variant 0.99
folC 2746391 p.Val403Ala missense_variant 1.0
Rv2752c 3067009 c.-818A>G upstream_gene_variant 0.99
thyX 3067812 p.Gln45Arg missense_variant 0.99
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 0.98
Rv3083 3448783 p.Val94Ile missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475113 c.1107G>A synonymous_variant 0.98
fprA 3475159 p.Asn385Asp missense_variant 1.0
fprA 3475323 c.1317T>C synonymous_variant 1.0
Rv3236c 3612694 c.423T>C synonymous_variant 1.0
fbiB 3641584 p.Val17Ala missense_variant 0.99
clpC1 4039853 c.852G>A synonymous_variant 1.0
panD 4044134 p.Asp50Asn missense_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244154 p.Thr308Ala missense_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
ethA 4327042 p.Asp144Asn missense_variant 0.98
ethA 4328211 c.-738A>G upstream_gene_variant 1.0
whiB6 4338269 p.Gly85Ser missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0