TB-Profiler result

Run: ERR3639801
Summary

Run ID: ERR3639801

Sample name:

Date: 01-04-2023 02:43:16

Number of reads: 2011414

Percentage reads mapped: 99.68

Strain: lineage3.1.2.1

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 1.0
lineage3.1.2 East-African-Indian CAS;CAS2 RD750 1.0
lineage3.1.2.1 East-African-Indian CAS2 RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4247729 p.Gly406Ser missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 0.99
rpoB 761998 p.Leu731Pro missense_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpR5 779300 p.Glu104Gly missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.27
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168604 p.Pro670Leu missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3449945 p.Gly481Ala missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4245705 p.His825Tyr missense_variant 1.0
aftB 4268066 c.771G>T synonymous_variant 0.34
ethA 4326657 p.Pro273Ser missense_variant 1.0
ethA 4326980 p.Gln165Arg missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407722 p.Ala161Pro missense_variant 0.28
gid 4407940 p.Val88Glu missense_variant 0.11
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0