TB-Profiler result

Run: ERR4799715

Summary

Run ID: ERR4799715

Sample name:

Date: 20-10-2023 04:05:49

Number of reads: 5942989

Percentage reads mapped: 99.57

Strain: lineage2.2.1

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (1.00)
Isoniazid R fabG1 c.-15C>T (0.97), katG p.Ser315Thr (0.99)
Ethambutol R embA c.-11C>A (0.97), embB p.Met306Val (1.00)
Pyrazinamide R pncA p.Leu27Pro (0.98)
Streptomycin R rpsL p.Lys43Arg (0.98)
Fluoroquinolones R gyrA p.Asp94Gly (0.98)
Moxifloxacin R gyrA p.Asp94Gly (0.98)
Ofloxacin R gyrA p.Asp94Gly (0.98)
Levofloxacin R gyrA p.Asp94Gly (0.98)
Ciprofloxacin R gyrA p.Asp94Gly (0.98)
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide R fabG1 c.-15C>T (0.97), ethA c.449_481delGATTCGCCGGCTCGGAGGATTTCGTCGGGCCGA (0.99), ethA c.448_481delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT (1.00)
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage2 East-Asian Beijing RD105 0.98
lineage2.2 East-Asian (Beijing) Beijing-RD207 RD105;RD207 0.98
lineage2.2.1 East-Asian (Beijing) Beijing-RD181 RD105;RD207;RD181 0.98
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Gly missense_variant 0.98 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 0.98 streptomycin
fabG1 1673425 c.-15C>T upstream_gene_variant 0.97 isoniazid, ethionamide
katG 2155168 p.Ser315Thr missense_variant 0.99 isoniazid
pncA 2289162 p.Leu27Pro missense_variant 0.98 pyrazinamide
embA 4243222 c.-11C>A upstream_gene_variant 0.97 ethambutol
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
ethA 4326992 c.449_481delGATTCGCCGGCTCGGAGGATTTCGTCGGGCCGA disruptive_inframe_deletion 0.99 ethionamide
ethA 4326992 c.448_481delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
ccsA 620625 p.Ile245Met missense_variant 0.98
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 766488 p.Pro1040Arg missense_variant 0.97
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 0.97
mmpS5 779615 c.-710C>G upstream_gene_variant 0.99
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1406760 c.580_581insC frameshift_variant 0.97
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834177 c.636A>C synonymous_variant 0.99
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568555 p.Leu42Pro missense_variant 0.97
whiB7 3568854 c.-176delG upstream_gene_variant 0.97
Rv3236c 3612813 p.Thr102Ala missense_variant 0.98
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243460 c.228C>T synonymous_variant 0.99
aftB 4267647 p.Asp397Gly missense_variant 0.98
ethA 4326676 p.Ser266Arg missense_variant 0.99
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 0.99
gid 4407927 p.Glu92Asp missense_variant 0.97