TB-Profiler result

Run: ERR4800023

Summary

Run ID: ERR4800023

Sample name:

Date: 20-10-2023 04:12:18

Number of reads: 1652479

Percentage reads mapped: 99.59

Strain: lineage2.2.1

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (0.91)
Isoniazid R katG p.Ser315Thr (0.95)
Ethambutol R embB p.Gly406Ser (0.92)
Pyrazinamide
Streptomycin R rpsL p.Lys43Arg (0.90)
Fluoroquinolones R gyrB p.Glu501Asp (0.90), gyrA p.Asp94Gly (0.93)
Moxifloxacin R gyrB p.Glu501Asp (0.90), gyrA p.Asp94Gly (0.93)
Ofloxacin R gyrB p.Glu501Asp (0.90), gyrA p.Asp94Gly (0.93)
Levofloxacin R gyrB p.Glu501Asp (0.90), gyrA p.Asp94Gly (0.93)
Ciprofloxacin R gyrB p.Glu501Asp (0.90), gyrA p.Asp94Gly (0.93)
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide R ethA p.Gln359* (0.97)
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage2 East-Asian Beijing RD105 0.95
lineage2.2 East-Asian (Beijing) Beijing-RD207 RD105;RD207 0.94
lineage2.2.1 East-Asian (Beijing) Beijing-RD181 RD105;RD207;RD181 0.95
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrB 6742 p.Glu501Asp missense_variant 0.9 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
gyrA 7582 p.Asp94Gly missense_variant 0.93 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 0.91 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 0.9 streptomycin
katG 2155168 p.Ser315Thr missense_variant 0.95 isoniazid
embB 4247729 p.Gly406Ser missense_variant 0.92 ethambutol
ethA 4326399 p.Gln359* stop_gained 0.97 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8649 p.Arg450Ser missense_variant 0.9
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491290 p.Val170Met missense_variant 0.98
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 575907 p.Ala187Val missense_variant 0.95
ccsA 620625 p.Ile245Met missense_variant 0.89
rpoC 763031 c.-339T>C upstream_gene_variant 0.97
rpoC 766488 p.Pro1040Arg missense_variant 0.92
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 776182 p.Asp767Asn missense_variant 0.88
mmpS5 779615 c.-710C>G upstream_gene_variant 0.89
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1406760 c.580_581insC frameshift_variant 0.95
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834177 c.636A>C synonymous_variant 0.91
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 0.97
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 0.11
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612813 p.Thr102Ala missense_variant 0.95
embC 4241022 p.Ala387Val missense_variant 0.88
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243460 c.228C>T synonymous_variant 0.95
aftB 4267647 p.Asp397Gly missense_variant 0.93
ethA 4326957 c.490_516dupCCGCAGCACTGGCCCGAGGACCTCGAC conservative_inframe_insertion 0.82
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407620 p.Tyr195His missense_variant 0.86
gid 4407927 p.Glu92Asp missense_variant 0.91