TB-Profiler result

Run: ERR4829824

Summary

Run ID: ERR4829824

Sample name:

Date: 20-10-2023 06:27:10

Number of reads: 3946366

Percentage reads mapped: 99.52

Strain: lineage3

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.His445Asp (1.00)
Isoniazid R katG p.Ser315Thr (1.00)
Ethambutol R embB p.Glu504Asp (1.00), embB p.Asp1024Asn (1.00)
Pyrazinamide
Streptomycin R rpsL p.Lys88Thr (1.00), gid c.351delG (1.00)
Fluoroquinolones R gyrA p.Ala90Val (1.00)
Moxifloxacin R gyrA p.Ala90Val (1.00)
Ofloxacin R gyrA p.Ala90Val (1.00)
Levofloxacin R gyrA p.Ala90Val (1.00)
Ciprofloxacin R gyrA p.Ala90Val (1.00)
Aminoglycosides R rrs n.1401A>G (1.00)
Amikacin R rrs n.1401A>G (1.00)
Capreomycin R rrs n.1401A>G (1.00)
Kanamycin R rrs n.1401A>G (1.00)
Cycloserine
Ethionamide
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7570 p.Ala90Val missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761139 p.His445Asp missense_variant 1.0 rifampicin
rpsL 781822 p.Lys88Thr missense_variant 1.0 streptomycin
rrs 1473246 n.1401A>G non_coding_transcript_exon_variant 1.0 kanamycin, capreomycin, aminoglycosides, amikacin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4248025 p.Glu504Asp missense_variant 1.0 ethambutol
embB 4249583 p.Asp1024Asn missense_variant 1.0 ethambutol
gid 4407851 c.351delG frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491545 p.Thr255Ala missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834711 c.1171_1191dupATCTTCCCCGAGGGCTTCGAT conservative_inframe_insertion 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ribD 2987187 c.349C>T synonymous_variant 1.0
thyA 3074264 c.201_207delCAATATC frameshift_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247633 p.Gly374Trp missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4408020 c.183C>G synonymous_variant 1.0