TB-Profiler result

Run: ERR9806927

Summary

Run ID: ERR9806927

Sample name:

Date: 18-05-2023 19:02:54

Number of reads: 2757781

Percentage reads mapped: 99.69

Strain: lineage4.8

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (1.00)
Isoniazid R katG p.Ser315Thr (1.00)
Ethambutol R embB p.Met306Val (1.00)
Pyrazinamide R pncA p.Met175Val (1.00)
Streptomycin R rpsL p.Lys43Arg (1.00)
Fluoroquinolones R gyrB p.Asp461Asn (1.00), gyrB p.Ala504Val (0.17), gyrA p.Ala90Val (0.51), gyrA p.Ser91Pro (0.21)
Moxifloxacin R gyrB p.Asp461Asn (1.00), gyrB p.Ala504Val (0.17), gyrA p.Ala90Val (0.51), gyrA p.Ser91Pro (0.21)
Ofloxacin R gyrB p.Asp461Asn (1.00), gyrB p.Ala504Val (0.17), gyrA p.Ala90Val (0.51), gyrA p.Ser91Pro (0.21)
Levofloxacin R gyrB p.Asp461Asn (1.00), gyrB p.Ala504Val (0.17), gyrA p.Ala90Val (0.51), gyrA p.Ser91Pro (0.21)
Ciprofloxacin R gyrB p.Asp461Asn (1.00), gyrB p.Ala504Val (0.17), gyrA p.Ala90Val (0.51), gyrA p.Ser91Pro (0.21)
Aminoglycosides
Amikacin
Capreomycin R tlyA c.139_140insA (0.42)
Kanamycin R eis c.-12C>T (1.00)
Cycloserine
Ethionamide R ethA c.867_934delGGACCAGCGATTGTGCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGG (1.00)
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrB 6620 p.Asp461Asn missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
gyrB 6750 p.Ala504Val missense_variant 0.17 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
gyrA 7570 p.Ala90Val missense_variant 0.51 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
gyrA 7572 p.Ser91Pro missense_variant 0.21 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
tlyA 1918078 c.139_140insA frameshift_variant 0.42 capreomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288719 p.Met175Val missense_variant 1.0 pyrazinamide
eis 2715344 c.-12C>T upstream_gene_variant 1.0 kanamycin
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
ethA 4326539 c.867_934delGGACCAGCGATTGTGCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGG frameshift_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5077 c.-163_-162insC upstream_gene_variant 0.13
gyrA 7362 p.Glu21Gln missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.27
rpoC 765862 p.Phe831Leu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168149 p.Pro822Ser missense_variant 1.0
PPE35 2169149 c.1464G>C synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288949 p.Ala98Val missense_variant 1.0
Rv3083 3448497 c.-7T>A upstream_gene_variant 1.0
clpC1 4039729 p.Asp326Asn missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.32
whiB6 4338595 c.-75delG upstream_gene_variant 1.0