TB-Profiler result

Run: ERR10867591

Summary

Run ID: ERR10867591

Sample name:

Date: 2024-03-27T02:35:48.615447

Number of reads: 4907965

Percentage reads mapped: 99.63

Median coverage: 250.0

Strain: lineage4.2.1.1

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
lineage4.2.1.1 Euro-American (TUR) None 1.0
lineage4.2.1 Euro-American (TUR) None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.His445Leu Assoc w R
isoniazid inhA c.-779G>T Assoc w R - Interim Alias fabG1_c.-17G>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Gly406Ala Assoc w R
p.Asp1024Asn Uncertain significance Mutation from literature
pyrazinamide pncA p.Val44Gly Assoc w R - Interim
streptomycin rrs n.514A>C Assoc w R
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide inhA c.-779G>T Assoc w R - Interim Alias fabG1_c.-17G>T
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Assoc w R - Interim Confers DLM-PMD cross-resistance
c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT Assoc w R - Interim Confers DLM-PMD cross-resistance
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761140 p.His445Leu missense_variant 1.0 rifampicin Assoc w R
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.29 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
rrs 1472359 n.514A>C non_coding_transcript_exon_variant 1.0 streptomycin Assoc w R
inhA 1673423 c.-779G>T upstream_gene_variant 1.0 isoniazid Assoc w R - Interim Alias fabG1_c.-17G>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ethionamide Assoc w R - Interim Alias fabG1_c.-17G>T
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2289111 p.Val44Gly missense_variant 1.0 pyrazinamide Assoc w R - Interim
embB 4247730 p.Gly406Ala missense_variant 1.0 ethambutol Assoc w R
embB 4249583 p.Asp1024Asn missense_variant 1.0 ethambutol Uncertain significance Mutation from literature
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
ccsA 620511 c.621C>T synonymous_variant 1.0 capreomycin Not assoc w R - Interim
amikacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 777451 p.Val344Leu missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800204 c.-605T>C upstream_gene_variant 1.0 linezolid
Rv1129c 1254582 c.-48A>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrl 1474425 n.768A>G non_coding_transcript_exon_variant 0.14 capreomycin
linezolid
rrl 1474428 n.771C>T non_coding_transcript_exon_variant 0.13 capreomycin
linezolid
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2063685 c.1044G>A synonymous_variant 1.0 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063911 p.Ile273Thr missense_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
ndh 2103023 p.Pro7Leu missense_variant 1.0 ethionamide Uncertain significance
delamanid Uncertain significance
isoniazid Uncertain significance
PPE35 2169879 p.Phe245Cys missense_variant 1.0 pyrazinamide Uncertain significance
PPE35 2170048 p.Leu189Val missense_variant 0.28 pyrazinamide
PPE35 2170053 p.Thr187Ser missense_variant 0.27 pyrazinamide
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
ald 3086742 c.-78A>C upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
fbiD 3339744 c.627A>C synonymous_variant 0.12 clofazimine
pretomanid
delamanid
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
rpoA 3878567 c.-60C>G upstream_gene_variant 0.25 rifampicin
rpoA 3878599 c.-92C>G upstream_gene_variant 0.18 rifampicin
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embB 4246544 p.Thr11Pro missense_variant 0.23 ethambutol Uncertain significance
embB 4246548 p.Pro12Gln missense_variant 0.26 ethambutol Uncertain significance
embB 4246555 c.42G>C synonymous_variant 0.24 ethambutol
embB 4246556 p.Ala15Pro missense_variant 0.24 ethambutol Uncertain significance
embB 4246563 p.Leu17Trp missense_variant 0.25 ethambutol Uncertain significance
embB 4246567 c.54G>T synonymous_variant 0.24 ethambutol Not assoc w R - Interim
ethA 4327377 p.Ala33Pro missense_variant 1.0 ethionamide Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407598 p.Val202Glu missense_variant 1.0 streptomycin
gid 4408213 c.-11C>T upstream_gene_variant 1.0 streptomycin Uncertain significance