TB-Profiler result

Run: ERR1664642

Summary

Run ID: ERR1664642

Sample name:

Date: 31-03-2023 14:54:04

Number of reads: 2011095

Percentage reads mapped: 99.69

Strain: lineage4.3.4.2

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7572 p.Ser91Pro missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
inhA 1674481 p.Ser94Ala missense_variant 1.0 isoniazid, ethionamide
tlyA 1918690 c.753_754dupGT frameshift_variant 0.99 capreomycin, capreomycin
eis 2715342 c.-10G>A upstream_gene_variant 1.0 kanamycin
alr 3840393 p.Met343Thr missense_variant 1.0 cycloserine
embA 4243222 c.-11C>A upstream_gene_variant 1.0 ethambutol
embB 4247702 p.Pro397Thr missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 6817 c.-485G>A upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
rpoC 766823 p.Lys1152Gln missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 0.99
mmpR5 779181 c.198delG frameshift_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.24
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472920 n.1077dupT non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289240 c.2T>C start_lost 1.0
folC 2747307 p.Ser98Gly missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 0.97
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243221 c.-12C>A upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 0.98
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0