TB-Profiler result

Run: ERR4800284

Summary

Run ID: ERR4800284

Sample name:

Date: 16-08-2022 09:00:49

Number of reads: 3358467

Percentage reads mapped: 99.39

Strain: lineage3

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Ala missense_variant 0.99 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 0.98 rifampicin
rpoC 764948 p.Leu527Val missense_variant 0.98 rifampicin
inhA 1674048 c.-154G>A upstream_gene_variant 0.99 isoniazid, ethionamide
katG 2155168 p.Ser315Thr missense_variant 0.97 isoniazid
pncA 2288961 p.Phe94Ser missense_variant 0.98 pyrazinamide
eis 2715344 c.-12C>T upstream_gene_variant 0.15 kanamycin
embB 4247431 p.Met306Ile missense_variant 1.0 ethambutol
embB 4247729 p.Gly406Cys missense_variant 0.97 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8694 c.1393C>T synonymous_variant 0.98
gyrA 9164 c.1863G>A synonymous_variant 0.99
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 0.99
mmpR5 779000 p.Asn4Thr missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472753 n.908A>C non_coding_transcript_exon_variant 0.97
rrl 1473609 n.-49G>C upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154243 c.1869G>A synonymous_variant 0.99
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2169052 p.Asn521Asp missense_variant 0.97
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 0.99
pncA 2289365 c.-125delC upstream_gene_variant 1.0
ahpC 2726105 c.-88G>A upstream_gene_variant 0.99
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3086906 c.89dupG frameshift_variant 0.95
Rv3083 3449108 p.Gly202Asp missense_variant 0.99
fprA 3473996 c.-11_-10insA upstream_gene_variant 0.99
embC 4242075 p.Arg738Gln missense_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4327502 c.-49_-30delTGTCGACATCTCGTTGACGG upstream_gene_variant 0.98
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4408000 p.Ile68Ser missense_variant 0.98
thyA 3074456 c.-2898_15del conservative_inframe_deletion 1.0