TB-Profiler result

Run: SRR6797743

Summary

Run ID: SRR6797743

Sample name:

Date: 2024-04-14T03:50:09.449742

Number of reads: 2515261

Percentage reads mapped: 99.47

Median coverage: 56.0

Strain: lineage3

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage3 East-African-Indian RD750 0.92
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Val Assoc w R
pyrazinamide
streptomycin gid p.Ser70Asn Assoc w R
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761155 p.Ser450Leu missense_variant 0.96 rifampicin Assoc w R
inhA 1673425 c.-777C>T upstream_gene_variant 0.93 isoniazid Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ethionamide Assoc w R Alias fabG1_c.-15C>T
katG 2155168 p.Ser315Thr missense_variant 0.98 isoniazid Assoc w R High-level resistance
embB 4247429 p.Met306Val missense_variant 0.98 ethambutol Assoc w R
gid 4407994 p.Ser70Asn missense_variant 0.91 streptomycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
Rv0565c 656546 p.Ile309Val missense_variant 0.95 ethionamide Uncertain significance
Rv0565c 657081 c.390G>A synonymous_variant 0.94 ethionamide Not assoc w R - Interim
rpoB 759746 c.-61C>T upstream_gene_variant 0.94 rifampicin Not assoc w R
rpoB 762434 c.2628T>G synonymous_variant 0.94 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 764363 p.Gly332Ser missense_variant 0.91 rifampicin Uncertain significance
rpoC 765171 p.Pro601Leu missense_variant 0.14 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800434 c.-374_-342delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN upstream_gene_variant 0.93 linezolid
rplC 800434 c.-374_-343delGGGGAGCACCGGACCCGGATACGGGCTCGAGT upstream_gene_variant 0.89 linezolid
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2289365 c.-125delC upstream_gene_variant 0.89 pyrazinamide
ahpC 2726105 c.-88G>A upstream_gene_variant 0.95 isoniazid Not assoc w R
Rv2477c 2782498 c.1545C>T synonymous_variant 0.95 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
kanamycin Not assoc w R
rifampicin Not assoc w R
amikacin Not assoc w R
Rv2752c 3065226 c.966G>A synonymous_variant 0.94 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv2752c 3066110 p.Gly28Ser missense_variant 0.92 ethambutol Uncertain significance
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Uncertain significance
isoniazid Uncertain significance
Rv2752c 3066376 c.-185C>T upstream_gene_variant 0.96 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
alr 3841253 c.168C>T synonymous_variant 0.13 cycloserine
panD 4044872 c.-591C>T upstream_gene_variant 0.95 pyrazinamide
glpK 4138622 c.1134C>T synonymous_variant 0.98 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
glpK 4139246 c.510C>T synonymous_variant 0.9 ethambutol Not assoc w R
moxifloxacin Not assoc w R - Interim
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R - Interim
embC 4242075 p.Arg738Gln missense_variant 0.93 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R