TB-Profiler result

Run: ERR10225516

Summary

Run ID: ERR10225516

Sample name:

Date: 31-03-2023 09:14:50

Number of reads: 5958759

Percentage reads mapped: 99.94

Strain: lineage1.1.2

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage1 Indo-Oceanic EAI RD239 1.0
lineage1.1 Indo-Oceanic EAI3;EAI4;EAI5;EAI6 RD239 1.0
lineage1.1.2 Indo-Oceanic EAI3;EAI5 RD239 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpoB 761244 p.Ile480Val missense_variant 0.89 rifampicin
rpsL 781822 p.Lys88Met missense_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288832 p.His137Pro missense_variant 1.0 pyrazinamide
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6112 p.Met291Ile missense_variant 1.0
gyrB 6124 c.885C>T synonymous_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8452 p.Ala384Val missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.22
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 763884 p.Ala172Val missense_variant 1.0
rpoC 763886 c.517C>A synonymous_variant 1.0
rpoC 765171 p.Pro601Leu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 800696 c.-113C>T upstream_gene_variant 1.0
fbiC 1303835 p.Ala302Val missense_variant 1.0
embR 1417019 p.Cys110Tyr missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2167983 p.Gly877Asp missense_variant 1.0
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288777 c.465G>T synonymous_variant 0.99
kasA 2518132 c.18C>T synonymous_variant 1.0
ahpC 2726051 c.-142G>A upstream_gene_variant 1.0
ahpC 2726468 c.276G>A synonymous_variant 1.0
pepQ 2860395 c.24C>T synonymous_variant 1.0
Rv2752c 3064632 c.1560C>T synonymous_variant 1.0
thyX 3067491 p.Ala152Val missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448714 p.Asp71His missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474597 c.591C>A synonymous_variant 1.0
fprA 3474881 p.Asn292Ser missense_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
Rv3236c 3611985 p.Pro378Ser missense_variant 1.0
rpoA 3878580 c.-113_-74delCAACCCAACCCTCGGGGGGCGCCGCCCCCCGAGTACCCCC upstream_gene_variant 1.0
clpC1 4040517 p.Val63Ala missense_variant 1.0
panD 4044461 c.-180G>T upstream_gene_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embC 4241042 p.Asn394Asp missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243848 p.Val206Met missense_variant 1.0
embA 4245969 p.Pro913Ser missense_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
embB 4248073 c.1560C>T synonymous_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338603 c.-82C>T upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407873 c.330G>T synonymous_variant 1.0