TB-Profiler result

Run: SRR25206917

Summary

Run ID: SRR25206917

Sample name:

Date: 28-01-2024 00:59:12

Number of reads: 5821429

Percentage reads mapped: 99.51

Strain: lineage2.2.2

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (1.00)
Isoniazid R fabG1 c.-15C>T (0.99)
Ethambutol R embB p.Gln497Arg (0.99)
Pyrazinamide R pncA p.Pro62Thr (1.00)
Streptomycin R rpsL p.Lys43Arg (1.00)
Fluoroquinolones R gyrA p.Asp94Gly (1.00)
Moxifloxacin R gyrA p.Asp94Gly (1.00)
Ofloxacin R gyrA p.Asp94Gly (1.00)
Levofloxacin R gyrA p.Asp94Gly (1.00)
Ciprofloxacin R gyrA p.Asp94Gly (1.00)
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide R fabG1 c.-15C>T (0.99)
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage2 East-Asian Beijing RD105 1.0
lineage2.2 East-Asian (Beijing) Beijing-RD207 RD105;RD207 1.0
lineage2.2.2 East-Asian (Beijing) Beijing-RD105/RD207 RD105;RD207 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Gly missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
fabG1 1673425 c.-15C>T upstream_gene_variant 0.99 isoniazid, ethionamide
pncA 2289058 p.Pro62Thr missense_variant 1.0 pyrazinamide
embB 4248003 p.Gln497Arg missense_variant 0.99 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6773 p.Gly512Arg missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 576727 p.Ile460Met missense_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 766488 p.Pro1040Arg missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834177 c.636A>C synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155219 p.Leu298Trp missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3064722 c.1468_1469dupCC frameshift_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0
rpoA 3878340 c.168C>T synonymous_variant 1.0
rpoA 3878614 c.-107A>C upstream_gene_variant 0.26
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243218 c.-15C>G upstream_gene_variant 1.0
embA 4243460 c.228C>T synonymous_variant 1.0
embB 4247028 p.Leu172Arg missense_variant 0.3
embB 4247033 p.Ser174Arg missense_variant 0.27
embB 4247039 p.Phe176Val missense_variant 0.18
aftB 4267647 p.Asp397Gly missense_variant 1.0
ethA 4327059 c.346_414delTGGACCGTTCACATCCAAAGCCACGGCACGCTCAGCGCCCTCACCTGCGAATTCCTCTTTCTGTGCAGC conservative_inframe_deletion 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407927 p.Glu92Asp missense_variant 1.0