TB-Profiler result

Run: ERR9786538

Summary

Run ID: ERR9786538

Sample name:

Date: 02-04-2023 12:31:36

Number of reads: 1741272

Percentage reads mapped: 89.73

Strain: lineage4.3.4.2

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 575466 p.Ala40Val missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.18
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472570 n.725G>A non_coding_transcript_exon_variant 0.13
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.13
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.12
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.13
rrs 1472659 n.814G>A non_coding_transcript_exon_variant 0.11
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.1
rrs 1472669 n.824_825insTAG non_coding_transcript_exon_variant 0.12
rrs 1472677 n.832C>G non_coding_transcript_exon_variant 0.11
rrs 1472678 n.833T>A non_coding_transcript_exon_variant 0.11
rrs 1472684 n.841_846delGATCCG non_coding_transcript_exon_variant 0.12
rrs 1472697 n.852T>A non_coding_transcript_exon_variant 0.12
rrs 1472700 n.855C>T non_coding_transcript_exon_variant 0.12
rrs 1472705 n.860G>A non_coding_transcript_exon_variant 0.12
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.15
rrs 1472715 n.870C>T non_coding_transcript_exon_variant 0.15
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.15
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.18
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.18
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.18
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.16
rrs 1472779 n.934G>A non_coding_transcript_exon_variant 0.14
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.14
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.11
rrs 1473070 n.1225G>A non_coding_transcript_exon_variant 0.12
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.17
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.19
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.23
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.21
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.21
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.21
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.21
rrl 1476297 n.2640C>A non_coding_transcript_exon_variant 0.2
rrl 1476301 n.2644A>C non_coding_transcript_exon_variant 0.21
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.2
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.22
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.22
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.22
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.23
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.23
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.27
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.26
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.26
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.27
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.27
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.27
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.29
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.29
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.22
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.21
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.11
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3065293 p.Val300Ala missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339014 c.-104C>A upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244841 p.Arg537Trp missense_variant 0.14
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0