TB-Profiler result

Run: SRR6855896
Summary

Run ID: SRR6855896

Sample name:

Date: 04-04-2023 17:49:22

Number of reads: 450512

Percentage reads mapped: 34.96

Strain: lineage4.3.4.2.1

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
lineage4.3.4.2.1 Euro-American (LAM) LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
ethA 4326166 c.1307delC frameshift_variant 0.12 ethionamide, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6140 p.Val301Leu missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7605 p.Pro102Ala missense_variant 0.12
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491181 c.399T>A synonymous_variant 0.11
rpoC 764995 c.1626C>G synonymous_variant 1.0
rpoC 766393 c.3024C>T synonymous_variant 1.0
rpoC 766642 c.3273C>T synonymous_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.3
Rv1258c 1407172 p.Phe57Ile missense_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472164 n.319G>A non_coding_transcript_exon_variant 0.18
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 0.21
rrs 1472177 n.332C>T non_coding_transcript_exon_variant 0.35
rrs 1472240 n.395G>C non_coding_transcript_exon_variant 0.33
rrs 1472242 n.397C>T non_coding_transcript_exon_variant 0.33
rrs 1472251 n.406G>T non_coding_transcript_exon_variant 0.26
rrs 1472253 n.408G>T non_coding_transcript_exon_variant 0.26
rrs 1472256 n.411T>A non_coding_transcript_exon_variant 0.26
rrs 1472259 n.414C>A non_coding_transcript_exon_variant 0.26
rrs 1472390 n.545T>A non_coding_transcript_exon_variant 0.1
rrs 1472391 n.546C>T non_coding_transcript_exon_variant 0.1
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.25
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.23
rrs 1472754 n.909G>T non_coding_transcript_exon_variant 0.19
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.2
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.12
rrs 1473163 n.1318C>T non_coding_transcript_exon_variant 0.15
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.15
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.14
rrs 1473191 n.1346C>T non_coding_transcript_exon_variant 0.21
rrs 1473198 n.1354delC non_coding_transcript_exon_variant 0.21
rrs 1473202 n.1357C>T non_coding_transcript_exon_variant 0.21
rrs 1473206 n.1361G>A non_coding_transcript_exon_variant 0.21
rrl 1474226 n.569A>G non_coding_transcript_exon_variant 0.11
rrl 1475816 n.2159C>G non_coding_transcript_exon_variant 0.22
rrl 1475817 n.2160A>G non_coding_transcript_exon_variant 0.33
rrl 1476336 n.2679C>T non_coding_transcript_exon_variant 0.23
rrl 1476356 n.2699C>A non_coding_transcript_exon_variant 0.25
rrl 1476357 n.2700T>C non_coding_transcript_exon_variant 0.24
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.28
rrl 1476359 n.2702C>G non_coding_transcript_exon_variant 0.33
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.33
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.33
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.35
rrl 1476383 n.2726T>G non_coding_transcript_exon_variant 0.33
rrl 1476384 n.2727G>T non_coding_transcript_exon_variant 0.32
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.43
rrl 1476411 n.2754G>A non_coding_transcript_exon_variant 0.38
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.29
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.32
rrl 1476442 n.2785T>A non_coding_transcript_exon_variant 0.29
rrl 1476443 n.2786G>T non_coding_transcript_exon_variant 0.29
rrl 1476455 n.2798C>A non_coding_transcript_exon_variant 0.3
rrl 1476456 n.2799A>T non_coding_transcript_exon_variant 0.3
rrl 1476463 n.2806C>T non_coding_transcript_exon_variant 0.27
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.3
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.13
rrl 1476512 n.2855C>T non_coding_transcript_exon_variant 0.13
fabG1 1673252 c.-188C>T upstream_gene_variant 1.0
tlyA 1917893 c.-47G>T upstream_gene_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154020 p.Phe698Leu missense_variant 0.11
PPE35 2167886 c.2727C>T synonymous_variant 0.14
PPE35 2168213 c.2400G>A synonymous_variant 0.14
PPE35 2168971 p.Ile548Phe missense_variant 0.11
PPE35 2170533 p.Ala27Gly missense_variant 0.12
PPE35 2170559 c.54G>A synonymous_variant 0.12
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3067088 c.-897G>T upstream_gene_variant 0.11
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339583 p.Thr156Ser missense_variant 0.12
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
fbiA 3641024 p.Asp161Val missense_variant 0.11
alr 3840719 c.702A>G synonymous_variant 1.0
ddn 3986828 c.-16C>A upstream_gene_variant 0.11
clpC1 4038287 c.2418C>T synonymous_variant 1.0
clpC1 4039651 p.Val352Leu missense_variant 1.0
embC 4242084 p.Leu741Pro missense_variant 0.12
embC 4242095 p.Ala745Thr missense_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243775 c.543G>A synonymous_variant 0.12
embB 4245539 c.-975C>A upstream_gene_variant 0.14
embB 4249089 p.Val859Ala missense_variant 0.12
aftB 4267989 p.Ala283Val missense_variant 0.18
ubiA 4269688 p.Val49Ala missense_variant 0.12
ethR 4327366 c.-183T>C upstream_gene_variant 0.1
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0