TB-Profiler result

Run: ERR9786663
Summary

Run ID: ERR9786663

Sample name:

Date: 02-04-2023 12:38:44

Number of reads: 2738021

Percentage reads mapped: 84.78

Strain: lineage4.3.4.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 6817 c.-485G>A upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 0.99
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.21
embR 1416811 c.537G>A synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.11
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.12
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.12
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.12
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.12
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.11
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.11
rrs 1473070 n.1225G>A non_coding_transcript_exon_variant 0.11
rrs 1473089 n.1244A>C non_coding_transcript_exon_variant 0.12
rrs 1473093 n.1248C>A non_coding_transcript_exon_variant 0.12
rrs 1473094 n.1249T>A non_coding_transcript_exon_variant 0.12
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 0.12
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.12
rrs 1473115 n.1270G>C non_coding_transcript_exon_variant 0.12
rrs 1473161 n.1316A>C non_coding_transcript_exon_variant 0.11
rrs 1473164 n.1319C>G non_coding_transcript_exon_variant 0.11
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.11
rrs 1473179 n.1334C>T non_coding_transcript_exon_variant 0.12
rrs 1473192 n.1347A>G non_coding_transcript_exon_variant 0.13
rrs 1473205 n.1360T>C non_coding_transcript_exon_variant 0.11
rrl 1476246 n.2589G>A non_coding_transcript_exon_variant 0.14
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.16
rrl 1476252 n.2595T>C non_coding_transcript_exon_variant 0.14
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.17
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.17
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.17
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.17
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.16
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.17
rrl 1476297 n.2640C>A non_coding_transcript_exon_variant 0.16
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.16
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.16
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.17
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.17
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.19
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.2
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.21
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.22
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.21
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.2
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.2
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.19
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.18
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.19
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.18
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.15
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4326068 p.Arg469Gln missense_variant 1.0
whiB6 4338201 c.320dupG frameshift_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0