TB-Profiler result

Run: SRR10321138

Summary

Run ID: SRR10321138

Sample name:

Date: 2024-04-13T22:04:52.975032

Number of reads: 212907

Percentage reads mapped: 53.97

Median coverage: 9.0

Strain: La3

Spoligotype:

Drug-resistance: Other


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
La3 M.orygis None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin rrs n.888G>A Uncertain significance Mutation from literature
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
capreomycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
kanamycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.65 streptomycin Uncertain significance Mutation from literature
rrs 1473247 n.1402C>A non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance Mutation from literature
amikacin Uncertain significance Mutation from literature
kanamycin Uncertain significance Mutation from literature
rrs 1473329 n.1484G>T non_coding_transcript_exon_variant 0.5 capreomycin Assoc w R
amikacin Assoc w R
kanamycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6109 c.870G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6446 p.Ala403Ser missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Uncertain significance
gyrB 6717 p.Ile493Thr missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8930 c.1629C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
Rv0010c 13315 p.Ser82Pro missense_variant 1.0 isoniazid Not assoc w R
fgd1 490661 c.-122_-121insGCGAGC upstream_gene_variant 0.92 clofazimine
pretomanid
delamanid
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
fgd1 491749 p.Leu323Phe missense_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 778086 c.394dupG frameshift_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.6 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.6 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.58 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472681 n.837_838delTT non_coding_transcript_exon_variant 0.45 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472687 n.842_843insC non_coding_transcript_exon_variant 0.36 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.41 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.59 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.58 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.59 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.59 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.51 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.47 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.43 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472952 n.1107T>C non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472955 n.1110C>T non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.5 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.62 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.5 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.44 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.62 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.65 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.64 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.77 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.5 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.48 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.62 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.5 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.48 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473270 n.1425G>A non_coding_transcript_exon_variant 0.4 streptomycin
kanamycin Uncertain significance
capreomycin
amikacin Uncertain significance
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473290 n.1445delCinsTTT non_coding_transcript_exon_variant 0.44 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473305 n.1460G>T non_coding_transcript_exon_variant 0.44 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473316 n.1471C>T non_coding_transcript_exon_variant 0.5 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.33 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.38 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.33 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.38 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.48 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.72 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.5 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.54 capreomycin Not assoc w R
linezolid Uncertain significance
inhA 1673680 c.-522C>G upstream_gene_variant 1.0 ethionamide Uncertain significance
isoniazid Not assoc w R
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
katG 2154707 p.Val469Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2155503 c.609C>T synonymous_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2169279 c.1312_1333delAACAATGGTGTCTTTTACCGTG frameshift_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518132 c.18C>T synonymous_variant 1.0 isoniazid
ahpC 2726378 c.186T>A synonymous_variant 1.0 isoniazid Not assoc w R
Rv2752c 3067009 c.-818A>G upstream_gene_variant 1.0 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
thyX 3067812 p.Gln45Arg missense_variant 1.0 para-aminosalicylic_acid
ald 3086728 c.-92C>T upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3087084 c.266delA frameshift_variant 1.0 cycloserine
Rv3236c 3613600 c.-484G>A upstream_gene_variant 1.0 pyrazinamide
lpqB 3624350 c.561G>T synonymous_variant 0.82 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R
fbiB 3641584 p.Val17Ala missense_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338269 p.Gly85Ser missense_variant 1.0 capreomycin Uncertain significance
amikacin Uncertain significance
kanamycin Uncertain significance
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin