TB-Profiler result

Run: ERR2851354

Summary

Run ID: ERR2851354

Sample name:

Date: 31-03-2023 23:52:37

Number of reads: 21502

Percentage reads mapped: 16.78

Strain: lineage4.9

Drug-resistance: RR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761110 p.Asp435Val missense_variant 1.0 rifampicin
rrs 1472644 n.799C>T non_coding_transcript_exon_variant 0.2 streptomycin
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.52 streptomycin
rrs 1473247 n.1402C>A non_coding_transcript_exon_variant 0.33 kanamycin, capreomycin, aminoglycosides, amikacin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6247 c.1008G>A synonymous_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
fgd1 491446 p.Val222Phe missense_variant 0.5
fbiC 1302980 p.Val17Ala missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 1.0
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 1.0
rrs 1472282 n.437T>G non_coding_transcript_exon_variant 0.6
rrs 1472284 n.439C>T non_coding_transcript_exon_variant 0.6
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 0.6
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 0.6
rrs 1472290 n.445C>G non_coding_transcript_exon_variant 0.6
rrs 1472293 n.448C>A non_coding_transcript_exon_variant 0.6
rrs 1472324 n.479G>C non_coding_transcript_exon_variant 0.6
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 0.6
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 0.6
rrs 1472332 n.487A>G non_coding_transcript_exon_variant 0.6
rrs 1472333 n.488G>A non_coding_transcript_exon_variant 0.6
rrs 1472338 n.493A>G non_coding_transcript_exon_variant 0.6
rrs 1472344 n.499C>T non_coding_transcript_exon_variant 0.6
rrs 1472379 n.534T>C non_coding_transcript_exon_variant 0.6
rrs 1472400 n.555C>T non_coding_transcript_exon_variant 0.75
rrs 1472507 n.662C>G non_coding_transcript_exon_variant 0.44
rrs 1472517 n.672T>A non_coding_transcript_exon_variant 0.4
rrs 1472518 n.673G>T non_coding_transcript_exon_variant 0.4
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.35
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.47
rrs 1472544 n.699C>A non_coding_transcript_exon_variant 0.41
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.43
rrs 1472558 n.713G>A non_coding_transcript_exon_variant 0.41
rrs 1472566 n.721G>A non_coding_transcript_exon_variant 0.41
rrs 1472569 n.724G>A non_coding_transcript_exon_variant 0.38
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.5
rrs 1472579 n.734G>T non_coding_transcript_exon_variant 0.54
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.81
rrs 1472597 n.752G>A non_coding_transcript_exon_variant 0.17
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.52
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.52
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.65
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.85
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.69
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.19
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.75
rrs 1472670 n.825G>T non_coding_transcript_exon_variant 0.69
rrs 1472673 n.828T>G non_coding_transcript_exon_variant 0.94
rrs 1472674 n.829T>G non_coding_transcript_exon_variant 0.2
rrs 1472675 n.830T>C non_coding_transcript_exon_variant 0.92
rrs 1472677 n.832C>T non_coding_transcript_exon_variant 0.92
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.69
rrs 1472692 n.847T>C non_coding_transcript_exon_variant 0.19
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.73
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.71
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.24
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.61
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.69
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.6
rrs 1472755 n.910G>A non_coding_transcript_exon_variant 0.33
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.61
rrs 1472790 n.945T>C non_coding_transcript_exon_variant 0.5
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.42
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.62
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.86
rrs 1472825 n.980G>A non_coding_transcript_exon_variant 0.43
rrs 1472827 n.982G>T non_coding_transcript_exon_variant 0.57
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.86
rrs 1472836 n.991G>C non_coding_transcript_exon_variant 0.75
rrs 1472847 n.1002G>A non_coding_transcript_exon_variant 0.67
rrs 1472849 n.1005delT non_coding_transcript_exon_variant 0.33
rrs 1472857 n.1012A>G non_coding_transcript_exon_variant 0.33
rrs 1472859 n.1014G>T non_coding_transcript_exon_variant 0.5
rrs 1472860 n.1015C>G non_coding_transcript_exon_variant 0.67
rrs 1472861 n.1016G>T non_coding_transcript_exon_variant 0.83
rrs 1472864 n.1019C>T non_coding_transcript_exon_variant 0.33
rrs 1472873 n.1028C>A non_coding_transcript_exon_variant 0.4
rrs 1472874 n.1029C>T non_coding_transcript_exon_variant 0.33
rrs 1472875 n.1030T>A non_coding_transcript_exon_variant 0.75
rrs 1472880 n.1035G>A non_coding_transcript_exon_variant 0.4
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.62
rrs 1472952 n.1107T>C non_coding_transcript_exon_variant 1.0
rrs 1472955 n.1110C>T non_coding_transcript_exon_variant 1.0
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 1.0
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 1.0
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.75
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.67
rrs 1473008 n.1164delT non_coding_transcript_exon_variant 0.4
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.89
rrs 1473053 n.1208T>A non_coding_transcript_exon_variant 0.45
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.45
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.89
rrs 1473062 n.1217T>A non_coding_transcript_exon_variant 0.3
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.6
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.3
rrs 1473081 n.1236C>T non_coding_transcript_exon_variant 0.25
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.75
rrs 1473089 n.1244A>C non_coding_transcript_exon_variant 0.25
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.86
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.86
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.83
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.88
rrs 1473107 n.1262G>C non_coding_transcript_exon_variant 0.25
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.86
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.75
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.75
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.75
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.25
rrs 1473130 n.1285G>A non_coding_transcript_exon_variant 0.22
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.55
rrs 1473147 n.1302G>T non_coding_transcript_exon_variant 0.27
rrs 1473148 n.1303G>A non_coding_transcript_exon_variant 0.56
rrs 1473150 n.1305T>G non_coding_transcript_exon_variant 0.33
rrs 1473161 n.1316A>C non_coding_transcript_exon_variant 0.25
rrs 1473163 n.1318C>T non_coding_transcript_exon_variant 0.45
rrs 1473164 n.1319C>A non_coding_transcript_exon_variant 0.23
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.69
rrs 1473172 n.1327T>G non_coding_transcript_exon_variant 0.15
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.46
rrs 1473192 n.1347A>G non_coding_transcript_exon_variant 0.62
rrs 1473199 n.1356delA non_coding_transcript_exon_variant 0.62
rrs 1473205 n.1360T>C non_coding_transcript_exon_variant 0.62
rrs 1473248 n.1403G>A non_coding_transcript_exon_variant 0.38
rrs 1473249 n.1404T>C non_coding_transcript_exon_variant 0.38
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.62
rrs 1473255 n.1410A>G non_coding_transcript_exon_variant 0.33
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.62
rrs 1473260 n.1415G>T non_coding_transcript_exon_variant 0.33
rrs 1473274 n.1429C>T non_coding_transcript_exon_variant 0.38
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.62
rrs 1473280 n.1435G>A non_coding_transcript_exon_variant 0.29
rrs 1473281 n.1436C>G non_coding_transcript_exon_variant 0.29
rrs 1473282 n.1437C>G non_coding_transcript_exon_variant 0.29
rrs 1473288 n.1443C>A non_coding_transcript_exon_variant 0.43
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 0.62
rrs 1473291 n.1446G>T non_coding_transcript_exon_variant 0.57
rrs 1473296 n.1451G>C non_coding_transcript_exon_variant 0.38
rrs 1473297 n.1452G>C non_coding_transcript_exon_variant 0.38
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.62
rrs 1473303 n.1458T>C non_coding_transcript_exon_variant 0.38
rrs 1473305 n.1460G>T non_coding_transcript_exon_variant 0.62
rrs 1473316 n.1471C>A non_coding_transcript_exon_variant 0.6
rrs 1473318 n.1473G>A non_coding_transcript_exon_variant 0.43
rrs 1473319 n.1474C>T non_coding_transcript_exon_variant 0.43
rrs 1473327 n.1482A>G non_coding_transcript_exon_variant 0.5
rrs 1473328 n.1483C>T non_coding_transcript_exon_variant 0.5
rrs 1473352 n.1507C>T non_coding_transcript_exon_variant 0.33
rrl 1473676 n.19G>A non_coding_transcript_exon_variant 0.5
rrl 1473679 n.22T>C non_coding_transcript_exon_variant 0.5
rrl 1474316 n.659T>C non_coding_transcript_exon_variant 1.0
rrl 1474317 n.660G>A non_coding_transcript_exon_variant 1.0
rrl 1474348 n.691C>T non_coding_transcript_exon_variant 1.0
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 1.0
rrl 1474353 n.696A>T non_coding_transcript_exon_variant 1.0
rrl 1474354 n.697C>T non_coding_transcript_exon_variant 1.0
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 1.0
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 1.0
rrl 1474393 n.736A>G non_coding_transcript_exon_variant 0.67
rrl 1474402 n.745T>C non_coding_transcript_exon_variant 1.0
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 1.0
rrl 1474435 n.778G>T non_coding_transcript_exon_variant 1.0
rrl 1474437 n.781_782delAA non_coding_transcript_exon_variant 1.0
rrl 1474448 n.791T>C non_coding_transcript_exon_variant 1.0
rrl 1474467 n.810A>G non_coding_transcript_exon_variant 1.0
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 1.0
rrl 1474495 n.838G>A non_coding_transcript_exon_variant 0.67
rrl 1474498 n.841G>T non_coding_transcript_exon_variant 0.67
rrl 1474505 n.848C>G non_coding_transcript_exon_variant 0.67
rrl 1474508 n.851C>T non_coding_transcript_exon_variant 0.5
rrl 1474584 n.927C>T non_coding_transcript_exon_variant 0.67
rrl 1474627 n.970G>A non_coding_transcript_exon_variant 0.67
rrl 1474677 n.1020A>G non_coding_transcript_exon_variant 0.5
rrl 1474694 n.1037C>T non_coding_transcript_exon_variant 0.5
rrl 1474709 n.1053_1056delTGGT non_coding_transcript_exon_variant 0.5
rrl 1474717 n.1060_1061insGTGAG non_coding_transcript_exon_variant 0.5
rrl 1474723 n.1066G>A non_coding_transcript_exon_variant 0.5
rrl 1474734 n.1077G>A non_coding_transcript_exon_variant 0.5
rrl 1474736 n.1079C>T non_coding_transcript_exon_variant 0.33
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.5
rrl 1474751 n.1094G>A non_coding_transcript_exon_variant 0.33
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.4
rrl 1474777 n.1120T>C non_coding_transcript_exon_variant 0.4
rrl 1474779 n.1122G>A non_coding_transcript_exon_variant 0.4
rrl 1474782 n.1125G>A non_coding_transcript_exon_variant 0.4
rrl 1474783 n.1126G>A non_coding_transcript_exon_variant 0.5
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.71
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.22
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.75
rrl 1474825 n.1168G>A non_coding_transcript_exon_variant 0.25
rrl 1474827 n.1170C>T non_coding_transcript_exon_variant 0.62
rrl 1474830 n.1173A>T non_coding_transcript_exon_variant 0.43
rrl 1474831 n.1174A>T non_coding_transcript_exon_variant 0.71
rrl 1474839 n.1182C>T non_coding_transcript_exon_variant 0.25
rrl 1474844 n.1187G>T non_coding_transcript_exon_variant 0.25
rrl 1474864 n.1207C>T non_coding_transcript_exon_variant 0.5
rrl 1474883 n.1226T>C non_coding_transcript_exon_variant 0.29
rrl 1474892 n.1235G>A non_coding_transcript_exon_variant 0.4
rrl 1474896 n.1239A>G non_coding_transcript_exon_variant 0.5
rrl 1474902 n.1245T>C non_coding_transcript_exon_variant 0.4
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 0.4
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.8
rrl 1474913 n.1256T>A non_coding_transcript_exon_variant 0.67
rrl 1475722 n.2065G>T non_coding_transcript_exon_variant 0.4
rrl 1475751 n.2094C>T non_coding_transcript_exon_variant 0.4
rrl 1475752 n.2095C>T non_coding_transcript_exon_variant 0.4
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.4
rrl 1475757 n.2101_2104delACCC non_coding_transcript_exon_variant 0.4
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.4
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.4
rrl 1475869 n.2212C>A non_coding_transcript_exon_variant 0.5
rrl 1475881 n.2224T>C non_coding_transcript_exon_variant 0.67
rrl 1475883 n.2226A>T non_coding_transcript_exon_variant 0.67
rrl 1475898 n.2241A>G non_coding_transcript_exon_variant 0.67
rrl 1475899 n.2242G>A non_coding_transcript_exon_variant 0.67
rrl 1475916 n.2259C>G non_coding_transcript_exon_variant 0.75
rrl 1475937 n.2280A>T non_coding_transcript_exon_variant 0.67
rrl 1475943 n.2286G>A non_coding_transcript_exon_variant 0.67
rrl 1475952 n.2295A>G non_coding_transcript_exon_variant 1.0
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 0.5
rrl 1476130 n.2473G>A non_coding_transcript_exon_variant 0.6
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.6
rrl 1476135 n.2478T>C non_coding_transcript_exon_variant 0.29
rrl 1476141 n.2484A>G non_coding_transcript_exon_variant 0.38
rrl 1476153 n.2496T>C non_coding_transcript_exon_variant 0.64
rrl 1476164 n.2507A>G non_coding_transcript_exon_variant 0.18
rrl 1476165 n.2508T>G non_coding_transcript_exon_variant 0.7
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.75
rrl 1476195 n.2538C>A non_coding_transcript_exon_variant 0.58
rrl 1476196 n.2539C>A non_coding_transcript_exon_variant 0.58
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.75
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.75
rrl 1476204 n.2547C>A non_coding_transcript_exon_variant 0.58
rrl 1476210 n.2553G>T non_coding_transcript_exon_variant 0.58
rrl 1476211 n.2554G>T non_coding_transcript_exon_variant 0.58
rrl 1476212 n.2555T>C non_coding_transcript_exon_variant 0.58
rrl 1476214 n.2557G>C non_coding_transcript_exon_variant 0.7
rrl 1476215 n.2558C>A non_coding_transcript_exon_variant 0.7
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.26
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.58
rrl 1476227 n.2570C>T non_coding_transcript_exon_variant 0.58
rrl 1476229 n.2572C>T non_coding_transcript_exon_variant 0.6
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.17
rrl 1476250 n.2593C>G non_coding_transcript_exon_variant 0.7
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.73
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.17
rrl 1476253 n.2596A>G non_coding_transcript_exon_variant 0.17
rrl 1476256 n.2599A>G non_coding_transcript_exon_variant 0.17
rrl 1476257 n.2600G>C non_coding_transcript_exon_variant 0.7
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.9
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.66
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.26
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.67
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.89
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.88
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.89
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.86
rrl 1476299 n.2642C>G non_coding_transcript_exon_variant 0.22
rrl 1476300 n.2643G>T non_coding_transcript_exon_variant 0.22
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.88
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.67
rrl 1476308 n.2651G>C non_coding_transcript_exon_variant 0.21
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.89
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.89
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.68
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.66
rrl 1476337 n.2680C>T non_coding_transcript_exon_variant 0.21
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.67
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.77
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.72
rrl 1476359 n.2702C>G non_coding_transcript_exon_variant 0.19
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.73
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.73
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.29
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.64
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.62
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.6
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.91
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.91
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.47
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.86
rrl 1476501 n.2844C>T non_coding_transcript_exon_variant 0.17
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.79
rrl 1476513 n.2856G>T non_coding_transcript_exon_variant 0.17
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.25
rrl 1476515 n.2858C>T non_coding_transcript_exon_variant 0.6
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.3
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 0.83
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.88
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.62
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.86
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.43
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 0.83
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.67
rrl 1476544 n.2887T>C non_coding_transcript_exon_variant 0.29
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.67
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 1.0
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 1.0
rrl 1476607 n.2950C>T non_coding_transcript_exon_variant 1.0
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 1.0
rrl 1476614 n.2957A>T non_coding_transcript_exon_variant 1.0
rrl 1476616 n.2959A>G non_coding_transcript_exon_variant 1.0
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 1.0
rrl 1476629 n.2972C>A non_coding_transcript_exon_variant 1.0
fabG1 1673380 c.-60C>G upstream_gene_variant 0.5