TB-Profiler result

Run: SRR18053779
Summary

Run ID: SRR18053779

Sample name:

Date: 03-04-2023 19:15:42

Number of reads: 1771235

Percentage reads mapped: 74.02

Strain: La1.7.1

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
La1 M.bovis None None 1.0
La1.7 M.bovis None None 1.0
La1.7.1 M.bovis None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
pncA 2289073 p.His57Asp missense_variant 1.0 pyrazinamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5752 c.513G>A synonymous_variant 1.0
gyrA 6406 c.-896C>T upstream_gene_variant 1.0
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8285 c.984C>T synonymous_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9217 p.Asp639Ala missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472181 n.336G>A non_coding_transcript_exon_variant 0.12
rrs 1472223 n.378C>G non_coding_transcript_exon_variant 0.12
rrs 1472544 n.699C>T non_coding_transcript_exon_variant 0.24
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.33
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.33
rrs 1472573 n.728C>T non_coding_transcript_exon_variant 0.33
rrs 1472574 n.729T>A non_coding_transcript_exon_variant 0.33
rrs 1472579 n.734G>A non_coding_transcript_exon_variant 0.33
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.33
rrs 1472592 n.747C>T non_coding_transcript_exon_variant 0.41
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.41
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.41
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.42
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.43
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.4
rrs 1472659 n.814G>A non_coding_transcript_exon_variant 0.39
rrs 1472670 n.825G>T non_coding_transcript_exon_variant 0.34
rrs 1472672 n.828_838delTTTCCTTCCTT non_coding_transcript_exon_variant 0.37
rrs 1472690 n.845C>G non_coding_transcript_exon_variant 0.38
rrs 1472698 n.853A>C non_coding_transcript_exon_variant 0.37
rrs 1472701 n.856T>A non_coding_transcript_exon_variant 0.38
rrs 1472715 n.870C>T non_coding_transcript_exon_variant 0.41
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.41
rrs 1472719 n.874G>A non_coding_transcript_exon_variant 0.41
rrs 1472733 n.888G>T non_coding_transcript_exon_variant 0.4
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.4
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.41
rrs 1472742 n.897C>A non_coding_transcript_exon_variant 0.41
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.41
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.42
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.45
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.34
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.25
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.14
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.2
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.2
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.24
rrl 1476357 n.2700T>A non_coding_transcript_exon_variant 0.25
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.25
rrl 1476359 n.2702C>T non_coding_transcript_exon_variant 0.25
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.3
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.3
rrl 1476381 n.2724G>A non_coding_transcript_exon_variant 0.29
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.29
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.35
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.29
rrl 1476427 n.2770G>T non_coding_transcript_exon_variant 0.29
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.29
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.3
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.26
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.1
rpsA 1834859 p.Ala440Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2103173 c.-132delG upstream_gene_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 1.0
katG 2156025 c.87C>A synonymous_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168011 p.Ser868Arg missense_variant 1.0
PPE35 2168319 p.Thr765Ile missense_variant 1.0
PPE35 2168814 c.1798dupA frameshift_variant 1.0
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
Rv3083 3448783 p.Val94Ile missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474427 p.Val141Ile missense_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
fbiA 3640636 p.Ser32Pro missense_variant 1.0
fbiB 3642478 p.Asp315Ala missense_variant 1.0
rpoA 3878559 c.-124_-53delCGAGTACCCCCCAACCCAACCCTCGGGGGGCGCCGCCCCCCGAGTACCCCCACCCTCGGGGGCGCCGCCCCC upstream_gene_variant 1.0
clpC1 4038403 c.2302T>C synonymous_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4242970 c.-263C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embB 4246551 p.Asn13Ser missense_variant 1.0
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
aftB 4267858 p.Ile327Val missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0