TB-Profiler result

Run: ERR3559279

Summary

Run ID: ERR3559279

Sample name:

Date: 2024-03-25T20:39:36.956744

Number of reads: 4117997

Percentage reads mapped: 96.02

Median coverage: 129.0

Strain: lineage4.2.2

Spoligotype:

Drug-resistance: HR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.2.2 Euro-American (Ural) None 0.99
lineage4.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ethambutol
pyrazinamide
streptomycin rrs n.888G>A Uncertain significance Mutation from literature
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance Mutation from literature
inhA 1673425 c.-777C>T upstream_gene_variant 1.0 isoniazid Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ethionamide Assoc w R Alias fabG1_c.-15C>T
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6256 p.Lys339Asn missense_variant 0.99 levofloxacin
moxifloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8500 p.Ala400Gly missense_variant 0.99 levofloxacin
moxifloxacin
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
mshA 576077 c.730C>T synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776634 p.Asp616Ala missense_variant 0.99 clofazimine
bedaquiline
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800204 c.-605T>C upstream_gene_variant 1.0 linezolid
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472517 n.672T>A non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472518 n.673G>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472544 n.699C>A non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472570 n.725G>A non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472579 n.734G>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.25 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.24 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472665 n.820G>A non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472669 n.824_825insTGGA non_coding_transcript_exon_variant 0.2 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472678 n.833T>G non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472679 n.834T>C non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472682 n.839_843delGGGAT non_coding_transcript_exon_variant 0.19 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.18 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472695 n.850C>T non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472700 n.855C>T non_coding_transcript_exon_variant 0.19 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrl 1475751 n.2094C>G non_coding_transcript_exon_variant 0.1 capreomycin Uncertain significance
linezolid
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.1 capreomycin
linezolid
rrl 1475783 n.2126T>G non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475803 n.2146T>C non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475804 n.2147G>C non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475816 n.2159C>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475817 n.2160A>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476153 n.2496T>C non_coding_transcript_exon_variant 0.1 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.11 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476196 n.2539C>A non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476212 n.2555T>C non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476229 n.2572C>G non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>A non_coding_transcript_exon_variant 0.23 capreomycin Uncertain significance
linezolid
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.34 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>A non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.27 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.39 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.46 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.43 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.4 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.23 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 0.15 capreomycin
linezolid
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476537 n.2880A>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476573 n.2916A>C non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2063685 c.1044G>A synonymous_variant 0.99 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063911 p.Ile273Thr missense_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2154335 p.Gly593Ser missense_variant 1.0 isoniazid Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223770 c.-670_-607delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG upstream_gene_variant 1.0 clofazimine
bedaquiline
Rv1979c 2223770 c.-669_-607delTGGAAAATTACATCGCCCAGACGCGCGACAAGTTCCTCAGCGCGGCCACATCGTCCACTCCAC upstream_gene_variant 1.0 clofazimine
bedaquiline
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
ald 3086742 c.-78A>C upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612469 c.648A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407706 p.Arg166Pro missense_variant 1.0 streptomycin Uncertain significance