TB-Profiler result

Run: ERR3559281


Run ID: ERR3559281

Sample name:

Date: 2024-03-24T18:48:49.916412

Number of reads: 2990927

Percentage reads mapped: 95.68

Median coverage: 95.0

Strain: lineage4.2.2


Drug-resistance: HR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.2.2 Euro-American (Ural) None 0.99
lineage4.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
isoniazid inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
streptomycin rrs n.888G>A Uncertain significance Mutation from literature
ethionamide inhA c.-777C>T Assoc w R Alias fabG1_c.-15C>T
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.22 streptomycin Uncertain significance Mutation from literature
inhA 1673425 c.-777C>T upstream_gene_variant 0.99 ethionamide Assoc w R Alias fabG1_c.-15C>T
isoniazid Assoc w R Alias fabG1_c.-15C>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6256 p.Lys339Asn missense_variant 1.0 levofloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8500 p.Ala400Gly missense_variant 1.0 levofloxacin
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
mshA 576077 c.730C>T synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776634 p.Asp616Ala missense_variant 0.99 clofazimine
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800204 c.-605T>C upstream_gene_variant 1.0 linezolid
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.21 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472665 n.820G>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472669 n.824_825insTGGA non_coding_transcript_exon_variant 0.19 streptomycin
rrs 1472678 n.833T>G non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472679 n.834T>C non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472682 n.839_843delGGGAT non_coding_transcript_exon_variant 0.19 streptomycin
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.19 streptomycin
rrs 1472695 n.850C>T non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472700 n.855C>T non_coding_transcript_exon_variant 0.2 streptomycin
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472953 n.1108G>A non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>A non_coding_transcript_exon_variant 0.13 streptomycin
rrs 1472970 n.1125_1130delCGTAATinsTTCG non_coding_transcript_exon_variant 0.15 streptomycin
rrs 1472977 n.1132G>T non_coding_transcript_exon_variant 0.15 streptomycin
rrs 1472982 n.1137G>C non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472987 n.1142G>T non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472988 n.1143T>A non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>T non_coding_transcript_exon_variant 0.15 streptomycin
rrs 1473002 n.1157G>T non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473004 n.1159T>A non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473008 n.1163C>A non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473009 n.1164T>C non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.17 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrl 1475751 n.2094C>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.12 capreomycin
rrl 1475783 n.2126T>G non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475803 n.2146T>C non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475804 n.2147G>C non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475816 n.2159C>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475817 n.2160A>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475858 n.2201T>C non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476141 n.2484A>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476153 n.2496T>C non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.13 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476195 n.2538C>A non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476196 n.2539C>A non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.13 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.15 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476204 n.2547C>A non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476210 n.2553G>T non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476211 n.2554G>T non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476212 n.2555T>C non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476214 n.2557G>A non_coding_transcript_exon_variant 0.13 capreomycin
rrl 1476215 n.2558C>A non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476229 n.2572C>G non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>A non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.35 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>A non_coding_transcript_exon_variant 0.2 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.48 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.5 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.43 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.34 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 0.27 capreomycin
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.23 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476537 n.2880A>G non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476567 n.2910C>T non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476573 n.2916A>C non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476577 n.2920T>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2063685 c.1044G>A synonymous_variant 0.99 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063911 p.Ile273Thr missense_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2154335 p.Gly593Ser missense_variant 1.0 isoniazid Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223770 c.-670_-607delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG upstream_gene_variant 1.0 clofazimine
Rv1979c 2223770 c.-669_-607delTGGAAAATTACATCGCCCAGACGCGCGACAAGTTCCTCAGCGCGGCCACATCGTCCACTCCAC upstream_gene_variant 1.0 clofazimine
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0 ethambutol
ald 3086742 c.-78A>C upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612469 c.648A>G synonymous_variant 0.98 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407706 p.Arg166Pro missense_variant 1.0 streptomycin Uncertain significance