TB-Profiler result

Run: SRR11972300
Summary

Run ID: SRR11972300

Sample name:

Date: 03-04-2023 05:35:55

Number of reads: 2922191

Percentage reads mapped: 95.75

Strain: lineage2.2.1

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage2 East-Asian Beijing RD105 1.0
lineage2.2 East-Asian (Beijing) Beijing-RD207 RD105;RD207 1.0
lineage2.2.1 East-Asian (Beijing) Beijing-RD181 RD105;RD207;RD181 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288955 p.Lys96Thr missense_variant 0.99 pyrazinamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 575907 p.Ala187Val missense_variant 1.0
ccsA 620625 p.Ile245Met missense_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 0.99
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472489 n.644A>T non_coding_transcript_exon_variant 0.11
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.12
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.2
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.23
rrs 1472682 n.837T>A non_coding_transcript_exon_variant 0.24
rrs 1472683 n.838T>C non_coding_transcript_exon_variant 0.24
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.24
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.25
rrs 1472836 n.991G>A non_coding_transcript_exon_variant 0.12
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.11
rrs 1472988 n.1143T>C non_coding_transcript_exon_variant 0.11
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.12
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.12
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.14
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.14
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.11
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.1
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.1
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.12
rrs 1473283 n.1438T>C non_coding_transcript_exon_variant 0.1
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 0.14
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 0.15
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 0.16
rrl 1473757 n.100T>G non_coding_transcript_exon_variant 0.16
rrl 1473758 n.101G>A non_coding_transcript_exon_variant 0.16
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 0.14
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 0.12
rrl 1474384 n.727C>T non_coding_transcript_exon_variant 0.11
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 0.17
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 0.19
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.19
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.2
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 0.2
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.17
rrl 1474552 n.895C>T non_coding_transcript_exon_variant 0.18
rrl 1474709 n.1052G>A non_coding_transcript_exon_variant 0.11
rrl 1474710 n.1053T>G non_coding_transcript_exon_variant 0.11
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.12
rrl 1474734 n.1077G>T non_coding_transcript_exon_variant 0.12
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.14
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 0.14
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.16
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.16
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.13
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.13
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.12
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.1
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 0.12
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.12
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.14
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.12
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.12
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.12
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 0.11
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.13
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.12
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.13
rrl 1476256 n.2599A>G non_coding_transcript_exon_variant 0.15
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.15
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.12
rrl 1476297 n.2640C>G non_coding_transcript_exon_variant 0.14
rrl 1476298 n.2641C>G non_coding_transcript_exon_variant 0.14
rrl 1476300 n.2643G>A non_coding_transcript_exon_variant 0.14
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.14
rrl 1476309 n.2652G>C non_coding_transcript_exon_variant 0.15
rpsA 1834177 c.636A>C synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223072 c.93T>C synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
folC 2746299 p.Glu434Gln missense_variant 1.0
thyX 3067954 c.-9G>A upstream_gene_variant 1.0
thyA 3074115 c.278_356delTCTACGGTGTACAATGGCGATCGTGGCCGGCTCCATCCGGTGAGCACATCGACCAGATCAGCGCGGCGCTGGATTTGCT frameshift_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568752 c.-73C>T upstream_gene_variant 1.0
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243190 c.-43G>C upstream_gene_variant 1.0
embA 4243460 c.228C>T synonymous_variant 1.0
embA 4244777 p.Met515Ile missense_variant 1.0
aftB 4267647 p.Asp397Gly missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407927 p.Glu92Asp missense_variant 1.0
thyA 3074115 c.277_356delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG frameshift_variant 1.0