TB-Profiler result

Run: ERR502517

Summary

Run ID: ERR502517

Sample name:

Date: 01-04-2023 21:56:48

Number of reads: 560375

Percentage reads mapped: 20.92

Strain: lineage5.1.1

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage5 West-Africa 1 AFRI_2;AFRI_3 RD711 0.99
lineage5.1.1 West-Africa 1 AFRI_2;AFRI_3 RD711 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761127 p.Ser441Ala missense_variant 0.18 rifampicin
rrs 1472644 n.799C>T non_coding_transcript_exon_variant 0.24 streptomycin
rrs 1473247 n.1402C>A non_coding_transcript_exon_variant 0.47 kanamycin, capreomycin, aminoglycosides, amikacin
rrs 1473329 n.1484G>T non_coding_transcript_exon_variant 0.48 kanamycin, capreomycin, aminoglycosides, amikacin
katG 2156062 p.Ser17Asn missense_variant 0.17 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5150 c.-89delC upstream_gene_variant 1.0
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9566 c.2265C>T synonymous_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 761015 c.1209G>C synonymous_variant 0.2
rpoB 761021 c.1215G>C synonymous_variant 0.18
rpoB 761027 c.1221A>G synonymous_variant 0.18
rpoB 761031 p.Gln409Asn missense_variant 0.18
rpoB 761037 c.1231_1233delTTGinsCTC synonymous_variant 0.17
rpoB 761054 c.1248G>C synonymous_variant 0.21
rpoB 761058 p.Val418Thr missense_variant 0.23
rpoB 761088 c.1282_1283delAGinsTC synonymous_variant 0.29
rpoB 761096 c.1290G>C synonymous_variant 0.19
rpoB 761102 c.1296A>G synonymous_variant 0.35
rpoB 761132 c.1326G>T synonymous_variant 0.21
rpoB 761133 c.1327T>C synonymous_variant 0.31
rpoB 761150 c.1344A>C synonymous_variant 0.23
rpoB 761154 p.Ser450Lys missense_variant 0.15
rpoB 761159 c.1353G>C synonymous_variant 0.31
rpoB 761165 c.1359G>C synonymous_variant 0.23
rpoB 761180 c.1374A>C synonymous_variant 0.17
rpoB 761564 c.1758G>C synonymous_variant 0.18
rpoB 761565 p.Met587Leu missense_variant 0.18
rpoB 761570 c.1764T>C synonymous_variant 0.18
rpoB 761579 c.1773G>C synonymous_variant 0.2
rpoB 761600 c.1794T>C synonymous_variant 0.25
rpoB 761615 c.1809A>C synonymous_variant 0.25
rpoB 761633 c.1827G>C synonymous_variant 0.33
rpoB 762053 c.2247T>C synonymous_variant 0.2
rpoB 762057 p.Ile751Val missense_variant 0.18
rpoB 762062 c.2256T>C synonymous_variant 0.18
rpoB 762194 c.2388G>C synonymous_variant 0.17
rpoB 762197 c.2391C>G synonymous_variant 0.14
rpoB 762200 c.2394C>A synonymous_variant 0.19
rpoB 762206 c.2400C>G synonymous_variant 0.21
rpoB 762212 c.2406G>C synonymous_variant 0.2
rpoB 762221 c.2415G>A synonymous_variant 0.14
rpoB 762245 c.2439G>C synonymous_variant 0.25
rpoB 762248 c.2442G>C synonymous_variant 0.14
rpoB 762254 c.2448T>C synonymous_variant 0.21
rpoC 762842 c.-528G>C upstream_gene_variant 0.15
rpoC 762854 c.-516G>C upstream_gene_variant 0.19
rpoB 762855 p.Val1017Ile missense_variant 0.31
rpoB 762858 p.Thr1018Ser missense_variant 0.31
rpoC 762863 c.-507T>G upstream_gene_variant 0.29
rpoB 762879 p.Met1025Leu missense_variant 0.5
rpoC 762887 c.-483G>C upstream_gene_variant 0.36
rpoC 762896 c.-474G>C upstream_gene_variant 0.25
rpoC 762899 c.-471G>C upstream_gene_variant 0.19
rpoB 762911 p.Ile1035Met missense_variant 0.13
rpoC 762917 c.-453C>G upstream_gene_variant 0.21
rpoC 762926 c.-444C>G upstream_gene_variant 0.22
rpoC 762929 c.-441G>T upstream_gene_variant 0.5
rpoB 762937 p.Ser1044Cys missense_variant 0.14
rpoB 762939 p.Met1045Leu missense_variant 0.14
rpoB 762942 p.Ile1046Val missense_variant 0.14
rpoC 762947 c.-423C>G upstream_gene_variant 0.21
rpoC 762962 c.-408C>T upstream_gene_variant 0.26
rpoC 762965 c.-405T>C upstream_gene_variant 0.21
rpoC 762971 c.-399G>A upstream_gene_variant 0.14
rpoC 762983 c.-387C>T upstream_gene_variant 0.26
rpoC 762989 c.-381G>T upstream_gene_variant 0.15
rpoB 763005 p.Cys1067Gly missense_variant 0.14
rpoB 763014 p.Met1070Leu missense_variant 0.14
rpoB 763017 p.Gln1071Glu missense_variant 0.15
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 763043 c.-327G>C upstream_gene_variant 0.17
rpoC 763053 c.-317T>C upstream_gene_variant 0.17
rpoB 763075 p.Thr1090Ile missense_variant 0.15
rpoB 763077 p.Val1091His missense_variant 0.14
rpoC 763094 c.-276G>C upstream_gene_variant 0.14
rpoC 763100 c.-270G>A upstream_gene_variant 0.14
rpoC 763103 c.-267G>C upstream_gene_variant 0.27
rpoC 763115 c.-255T>C upstream_gene_variant 0.12
rpoC 763133 c.-237G>C upstream_gene_variant 0.14
rpoC 763148 c.-222G>C upstream_gene_variant 0.15
rpoC 763280 c.-90C>T upstream_gene_variant 1.0
rpoB 763293 p.Asn1163Asp missense_variant 0.14
rpoC 763456 c.87A>G synonymous_variant 0.17
rpoC 763468 c.99G>C synonymous_variant 0.15
rpoC 763483 c.114G>C synonymous_variant 0.2
rpoC 763486 c.117T>C synonymous_variant 0.33
rpoC 763492 c.123G>C synonymous_variant 0.29
rpoC 763507 c.138G>C synonymous_variant 0.28
rpoC 763528 c.159G>C synonymous_variant 0.26
rpoC 763531 c.162G>C synonymous_variant 0.26
rpoC 763532 p.Thr55Ser missense_variant 0.17
rpoC 763537 c.168C>G synonymous_variant 0.19
rpoC 763546 c.177A>G synonymous_variant 0.26
rpoC 763550 p.Tyr61Ala missense_variant 0.22
rpoC 763570 c.201G>C synonymous_variant 0.48
rpoC 763594 c.225C>T synonymous_variant 0.29
rpoC 763615 c.246G>C synonymous_variant 0.24
rpoC 763622 p.Ala85Ser missense_variant 0.14
rpoC 763633 c.264T>C synonymous_variant 0.15
rpoC 763636 c.267T>C synonymous_variant 0.16
rpoC 763642 c.273G>C synonymous_variant 0.25
rpoC 763660 c.291T>G synonymous_variant 0.21
rpoC 763666 c.297G>C synonymous_variant 0.19
rpoC 763669 c.300C>G synonymous_variant 0.24
rpoC 763675 c.306C>G synonymous_variant 0.26
rpoC 763696 c.327T>C synonymous_variant 0.15
rpoC 763699 c.330G>T synonymous_variant 0.3
rpoC 763705 c.336G>C synonymous_variant 0.27
rpoC 763708 c.339G>C synonymous_variant 0.48
rpoC 763714 c.345G>C synonymous_variant 0.38
rpoC 763717 c.348T>C synonymous_variant 0.36
rpoC 763720 c.351G>C synonymous_variant 0.15
rpoC 763723 c.354G>T synonymous_variant 0.17
rpoC 763732 c.363C>A synonymous_variant 0.22
rpoC 763744 c.375G>C synonymous_variant 0.27
rpoC 763751 p.Ile128Val missense_variant 0.24
rpoC 763765 c.396T>G synonymous_variant 0.13
rpoC 763772 p.Val135Met missense_variant 0.19
rpoC 764334 p.Pro322Gln missense_variant 0.2
rpoC 764344 c.975C>T synonymous_variant 0.14
rpoC 764359 c.990C>G synonymous_variant 0.19
rpoC 764371 c.1002G>C synonymous_variant 0.12
rpoC 764377 c.1008C>G synonymous_variant 0.13
rpoC 764387 c.1018_1020delTTGinsCTC synonymous_variant 0.13
rpoC 764405 c.1036_1038delAGGinsCGC synonymous_variant 0.13
rpoC 764428 c.1059G>C synonymous_variant 0.14
rpoC 764455 c.1086G>T synonymous_variant 0.19
rpoC 764461 c.1092A>G synonymous_variant 0.21
rpoC 764485 c.1116G>C synonymous_variant 0.22
rpoC 764491 c.1122G>T synonymous_variant 0.18
rpoC 764498 p.Ser377Ala missense_variant 0.25
rpoC 764503 c.1134G>C synonymous_variant 0.14
rpoC 764509 c.1140G>C synonymous_variant 0.29
rpoC 764521 c.1152T>C synonymous_variant 0.41
rpoC 764536 c.1167G>T synonymous_variant 0.5
rpoC 764539 c.1170C>G synonymous_variant 0.57
rpoC 764548 c.1179G>C synonymous_variant 0.36
rpoC 764549 p.Pro394Val missense_variant 0.17
rpoC 764560 c.1191T>C synonymous_variant 0.19
rpoC 764566 c.1197C>G synonymous_variant 0.24
rpoC 764572 c.1203G>C synonymous_variant 0.24
rpoC 764575 c.1206T>G synonymous_variant 0.27
rpoC 764576 c.1207_1208delTCinsAG synonymous_variant 0.12
rpoC 764581 c.1212T>C synonymous_variant 0.29
rpoC 764582 p.Leu405Met missense_variant 0.29
rpoC 764605 c.1236G>T synonymous_variant 0.21
rpoC 764611 c.1242G>C synonymous_variant 0.21
rpoC 764620 c.1251G>C synonymous_variant 0.18
rpoC 764632 c.1263T>C synonymous_variant 0.27
rpoC 764644 c.1275G>C synonymous_variant 0.14
rpoC 764650 c.1281G>T synonymous_variant 0.18
rpoC 764662 c.1293G>C synonymous_variant 0.25
rpoC 764677 c.1308C>G synonymous_variant 0.25
rpoC 764695 c.1326T>C synonymous_variant 0.2
rpoC 764706 p.Leu446Gln missense_variant 0.31
rpoC 764713 c.1344G>C synonymous_variant 0.12
rpoC 764746 c.1377G>C synonymous_variant 0.17
rpoC 764752 c.1383G>T synonymous_variant 0.14
rpoC 764758 c.1389C>G synonymous_variant 0.13
rpoC 764764 c.1395T>C synonymous_variant 0.19
rpoC 764780 c.1411_1412delAGinsTC synonymous_variant 0.17
rpoC 765638 p.Glu757Lys missense_variant 0.25
rpoC 765923 p.Asn852Ala missense_variant 0.21
rpoC 765937 c.2568T>C synonymous_variant 0.2
rpoC 765940 c.2571A>T synonymous_variant 0.15
rpoC 765947 c.2578T>C synonymous_variant 0.13
rpoC 765952 c.2583G>C synonymous_variant 0.2
rpoC 765958 c.2589C>G synonymous_variant 0.27
rpoC 765962 c.2593T>C synonymous_variant 0.29
rpoC 766053 p.Arg895His missense_variant 0.12
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 800654 c.-155T>C upstream_gene_variant 0.18
rplC 800667 c.-142_-140delTCGinsAGC upstream_gene_variant 0.29
rplC 800672 c.-137G>C upstream_gene_variant 0.25
rplC 800681 c.-128C>T upstream_gene_variant 0.3
rplC 800684 c.-125G>A upstream_gene_variant 0.3
rplC 800693 c.-116A>G upstream_gene_variant 0.25
rplC 800702 c.-107G>T upstream_gene_variant 0.21
rplC 800703 c.-106_-104delTTGinsCTT upstream_gene_variant 0.15
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
Rv1258c 1407273 p.Asp23Val missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472078 n.233C>T non_coding_transcript_exon_variant 0.17
rrs 1472089 n.244C>T non_coding_transcript_exon_variant 0.17
rrs 1472094 n.249T>A non_coding_transcript_exon_variant 0.3
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.65
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.35
rrs 1472112 n.267C>T non_coding_transcript_exon_variant 0.13
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 0.46
rrs 1472123 n.278A>G non_coding_transcript_exon_variant 0.17
rrs 1472124 n.279C>T non_coding_transcript_exon_variant 0.18
rrs 1472127 n.282C>T non_coding_transcript_exon_variant 0.53
rrs 1472129 n.284G>C non_coding_transcript_exon_variant 0.51
rrs 1472130 n.285G>A non_coding_transcript_exon_variant 0.37
rrs 1472137 n.292G>A non_coding_transcript_exon_variant 0.51
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.93
rrs 1472151 n.306C>T non_coding_transcript_exon_variant 0.65
rrs 1472155 n.310C>T non_coding_transcript_exon_variant 0.14
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 0.94
rrs 1472203 n.358G>A non_coding_transcript_exon_variant 0.42
rrs 1472210 n.365A>C non_coding_transcript_exon_variant 0.4
rrs 1472213 n.368G>C non_coding_transcript_exon_variant 0.39
rrs 1472222 n.377G>A non_coding_transcript_exon_variant 0.36
rrs 1472225 n.380C>A non_coding_transcript_exon_variant 0.53
rrs 1472229 n.384C>T non_coding_transcript_exon_variant 0.37
rrs 1472236 n.391C>G non_coding_transcript_exon_variant 0.34
rrs 1472240 n.395G>A non_coding_transcript_exon_variant 0.35
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.76
rrs 1472258 n.413A>G non_coding_transcript_exon_variant 0.24
rrs 1472259 n.414C>A non_coding_transcript_exon_variant 0.32
rrs 1472274 n.429A>G non_coding_transcript_exon_variant 0.19
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 0.3
rrs 1472330 n.485G>T non_coding_transcript_exon_variant 0.23
rrs 1472338 n.493A>G non_coding_transcript_exon_variant 0.47
rrs 1472344 n.499C>T non_coding_transcript_exon_variant 0.53
rrs 1472379 n.534T>C non_coding_transcript_exon_variant 0.5
rrs 1472382 n.537G>A non_coding_transcript_exon_variant 0.33
rrs 1472389 n.544G>A non_coding_transcript_exon_variant 0.33
rrs 1472400 n.555C>T non_coding_transcript_exon_variant 0.53
rrs 1472422 n.577T>C non_coding_transcript_exon_variant 0.47
rrs 1472494 n.649A>G non_coding_transcript_exon_variant 0.46
rrs 1472495 n.650C>A non_coding_transcript_exon_variant 0.29
rrs 1472496 n.651T>A non_coding_transcript_exon_variant 0.13
rrs 1472498 n.653C>T non_coding_transcript_exon_variant 0.48
rrs 1472507 n.662C>G non_coding_transcript_exon_variant 0.18
rrs 1472517 n.672T>A non_coding_transcript_exon_variant 0.23
rrs 1472518 n.673G>T non_coding_transcript_exon_variant 0.15
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.68
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.32
rrs 1472544 n.699C>A non_coding_transcript_exon_variant 0.16
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.27
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.31
rrs 1472558 n.713G>A non_coding_transcript_exon_variant 0.34
rrs 1472569 n.724G>A non_coding_transcript_exon_variant 0.36
rrs 1472570 n.725G>A non_coding_transcript_exon_variant 0.33
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.45
rrs 1472575 n.730C>T non_coding_transcript_exon_variant 0.25
rrs 1472579 n.734G>C non_coding_transcript_exon_variant 0.31
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.55
rrs 1472582 n.737G>T non_coding_transcript_exon_variant 0.36
rrs 1472584 n.739A>T non_coding_transcript_exon_variant 0.15
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.42
rrs 1472607 n.762G>A non_coding_transcript_exon_variant 0.32
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.47
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.53
rrs 1472655 n.810G>T non_coding_transcript_exon_variant 0.67
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.23
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.43
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.23
rrs 1472669 n.824_825insTGGA non_coding_transcript_exon_variant 0.5
rrs 1472678 n.833T>G non_coding_transcript_exon_variant 0.33
rrs 1472679 n.834T>C non_coding_transcript_exon_variant 0.38
rrs 1472682 n.839_843delGGGAT non_coding_transcript_exon_variant 0.38
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.27
rrs 1472692 n.847T>C non_coding_transcript_exon_variant 0.27
rrs 1472695 n.850C>T non_coding_transcript_exon_variant 0.31
rrs 1472697 n.852T>A non_coding_transcript_exon_variant 0.43
rrs 1472701 n.856T>A non_coding_transcript_exon_variant 0.14
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.68
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.24
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.72
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.5
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.19
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.67
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.45
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.72
rrs 1472790 n.945T>C non_coding_transcript_exon_variant 0.21
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.76
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.71
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.77
rrs 1472825 n.980G>A non_coding_transcript_exon_variant 0.25
rrs 1472827 n.982G>T non_coding_transcript_exon_variant 0.33
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.7
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.81
rrs 1472952 n.1107T>C non_coding_transcript_exon_variant 0.27
rrs 1472953 n.1108G>A non_coding_transcript_exon_variant 0.24
rrs 1472955 n.1110C>T non_coding_transcript_exon_variant 0.26
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.52
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.54
rrs 1472958 n.1113A>G non_coding_transcript_exon_variant 0.42
rrs 1472959 n.1114T>A non_coding_transcript_exon_variant 0.25
rrs 1472973 n.1128A>G non_coding_transcript_exon_variant 0.65
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.56
rrs 1472974 n.1129A>G non_coding_transcript_exon_variant 0.39
rrs 1472982 n.1137G>A non_coding_transcript_exon_variant 0.24
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.35
rrs 1472988 n.1143T>C non_coding_transcript_exon_variant 0.43
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.2
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.63
rrs 1473001 n.1156G>A non_coding_transcript_exon_variant 0.18
rrs 1473002 n.1157G>T non_coding_transcript_exon_variant 0.24
rrs 1473004 n.1159T>A non_coding_transcript_exon_variant 0.24
rrs 1473008 n.1163C>A non_coding_transcript_exon_variant 0.25
rrs 1473026 n.1181T>C non_coding_transcript_exon_variant 0.2
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.88
rrs 1473053 n.1208T>A non_coding_transcript_exon_variant 0.32
rrs 1473054 n.1209C>G non_coding_transcript_exon_variant 0.18
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.74
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.92
rrs 1473062 n.1217T>A non_coding_transcript_exon_variant 0.36
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.56
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.35
rrs 1473080 n.1235C>A non_coding_transcript_exon_variant 0.3
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.25
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.36
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 0.18
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.62
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.23
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.5
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.69
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.71
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.3
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.73
rrs 1473122 n.1277T>A non_coding_transcript_exon_variant 0.35
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.35
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.54
rrs 1473148 n.1303G>T non_coding_transcript_exon_variant 0.25
rrs 1473163 n.1318C>A non_coding_transcript_exon_variant 0.23
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.58
rrs 1473173 n.1328C>T non_coding_transcript_exon_variant 0.27
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.14
rrs 1473221 n.1376C>T non_coding_transcript_exon_variant 0.21
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.52
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.45
rrs 1473262 n.1417T>C non_coding_transcript_exon_variant 0.22
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.74
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.74
rrs 1473315 n.1470T>C non_coding_transcript_exon_variant 0.68
rrs 1473316 n.1471C>T non_coding_transcript_exon_variant 0.62
rrs 1473352 n.1507C>T non_coding_transcript_exon_variant 0.14
rrl 1473782 n.125A>G non_coding_transcript_exon_variant 0.22
rrl 1473783 n.126A>G non_coding_transcript_exon_variant 0.22
rrl 1473788 n.131A>G non_coding_transcript_exon_variant 0.22
rrl 1473797 n.140G>T non_coding_transcript_exon_variant 0.22
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 0.25
rrl 1473807 n.150T>C non_coding_transcript_exon_variant 0.25
rrl 1473811 n.154C>T non_coding_transcript_exon_variant 0.25
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 0.22
rrl 1473871 n.214T>C non_coding_transcript_exon_variant 0.67
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 0.86
rrl 1473888 n.231T>A non_coding_transcript_exon_variant 0.71
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 0.83
rrl 1473899 n.242A>T non_coding_transcript_exon_variant 0.8
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 0.2
rrl 1474155 n.498G>A non_coding_transcript_exon_variant 0.3
rrl 1474164 n.507C>T non_coding_transcript_exon_variant 0.36
rrl 1474166 n.509G>A non_coding_transcript_exon_variant 0.25
rrl 1474183 n.526T>C non_coding_transcript_exon_variant 0.56
rrl 1474184 n.527C>T non_coding_transcript_exon_variant 0.53
rrl 1474185 n.528G>A non_coding_transcript_exon_variant 0.32
rrl 1474197 n.540C>T non_coding_transcript_exon_variant 0.14
rrl 1474218 n.561T>A non_coding_transcript_exon_variant 0.5
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.67
rrl 1474264 n.607T>G non_coding_transcript_exon_variant 0.12
rrl 1474265 n.608G>T non_coding_transcript_exon_variant 0.12
rrl 1474266 n.609T>C non_coding_transcript_exon_variant 0.12
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 0.53
rrl 1474275 n.618T>G non_coding_transcript_exon_variant 0.18
rrl 1474348 n.691C>T non_coding_transcript_exon_variant 0.4
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 0.5
rrl 1474353 n.696A>T non_coding_transcript_exon_variant 0.22
rrl 1474354 n.697C>T non_coding_transcript_exon_variant 0.4
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 0.4
rrl 1474359 n.702C>G non_coding_transcript_exon_variant 0.2
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.55
rrl 1474363 n.706A>T non_coding_transcript_exon_variant 0.18
rrl 1474365 n.708G>C non_coding_transcript_exon_variant 0.17
rrl 1474381 n.724T>C non_coding_transcript_exon_variant 0.29
rrl 1474383 n.726G>T non_coding_transcript_exon_variant 0.12
rrl 1474384 n.727C>G non_coding_transcript_exon_variant 0.12
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.56
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 0.31
rrl 1474437 n.782_784delATA non_coding_transcript_exon_variant 0.31
rrl 1474448 n.791T>C non_coding_transcript_exon_variant 0.18
rrl 1474450 n.793T>A non_coding_transcript_exon_variant 0.24
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 0.29
rrl 1474466 n.809G>A non_coding_transcript_exon_variant 0.35
rrl 1474467 n.810A>G non_coding_transcript_exon_variant 0.23
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 0.7
rrl 1474495 n.838G>A non_coding_transcript_exon_variant 0.33
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 0.38
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.37
rrl 1474498 n.841G>T non_coding_transcript_exon_variant 0.34
rrl 1474505 n.848C>G non_coding_transcript_exon_variant 0.34
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.47
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 0.47
rrl 1474508 n.851C>T non_coding_transcript_exon_variant 0.34
rrl 1474516 n.859C>A non_coding_transcript_exon_variant 0.81
rrl 1474527 n.870T>C non_coding_transcript_exon_variant 0.36
rrl 1474529 n.872A>C non_coding_transcript_exon_variant 0.41
rrl 1474530 n.873G>A non_coding_transcript_exon_variant 0.42
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.84
rrl 1474539 n.882C>T non_coding_transcript_exon_variant 0.43
rrl 1474540 n.883T>G non_coding_transcript_exon_variant 0.43
rrl 1474542 n.885A>G non_coding_transcript_exon_variant 0.29
rrl 1474583 n.926C>T non_coding_transcript_exon_variant 0.53
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.41
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.93
rrl 1474634 n.977T>G non_coding_transcript_exon_variant 0.33
rrl 1474636 n.979A>C non_coding_transcript_exon_variant 0.81
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.88
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.58
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 0.84
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 0.58
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 0.37
rrl 1474658 n.1001A>G non_coding_transcript_exon_variant 0.33
rrl 1474663 n.1006C>T non_coding_transcript_exon_variant 0.68
rrl 1474664 n.1007G>A non_coding_transcript_exon_variant 0.26
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 0.44
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 0.81
rrl 1474677 n.1020A>G non_coding_transcript_exon_variant 0.35
rrl 1474692 n.1035G>A non_coding_transcript_exon_variant 0.5
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.17
rrl 1474723 n.1066G>A non_coding_transcript_exon_variant 0.15
rrl 1474734 n.1077G>C non_coding_transcript_exon_variant 0.5
rrl 1474736 n.1079C>T non_coding_transcript_exon_variant 0.3
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.3
rrl 1474751 n.1094G>A non_coding_transcript_exon_variant 0.29
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 0.62
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.87
rrl 1474777 n.1120T>C non_coding_transcript_exon_variant 0.49
rrl 1474779 n.1122G>A non_coding_transcript_exon_variant 0.5
rrl 1474782 n.1125G>A non_coding_transcript_exon_variant 0.4
rrl 1474783 n.1126G>A non_coding_transcript_exon_variant 0.35
rrl 1474790 n.1133C>T non_coding_transcript_exon_variant 0.16
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.66
rrl 1474801 n.1144G>A non_coding_transcript_exon_variant 0.18
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.24
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.59
rrl 1474824 n.1167A>G non_coding_transcript_exon_variant 0.32
rrl 1474827 n.1170C>T non_coding_transcript_exon_variant 0.5
rrl 1474830 n.1173A>C non_coding_transcript_exon_variant 0.52
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.58
rrl 1474831 n.1174A>C non_coding_transcript_exon_variant 0.82
rrl 1474844 n.1187G>T non_coding_transcript_exon_variant 0.21
rrl 1474864 n.1207C>T non_coding_transcript_exon_variant 0.33
rrl 1474866 n.1209C>A non_coding_transcript_exon_variant 0.21
rrl 1474869 n.1212G>A non_coding_transcript_exon_variant 0.28
rrl 1474896 n.1239A>G non_coding_transcript_exon_variant 0.2
rrl 1474902 n.1245T>C non_coding_transcript_exon_variant 0.19
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 0.2
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.59
rrl 1474905 n.1248T>C non_coding_transcript_exon_variant 0.41
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.72
rrl 1474920 n.1263G>C non_coding_transcript_exon_variant 0.17
rrl 1474928 n.1271C>A non_coding_transcript_exon_variant 0.19
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.31
rrl 1474933 n.1276A>G non_coding_transcript_exon_variant 0.12
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 0.25
rrl 1475059 n.1403_1404insTA non_coding_transcript_exon_variant 0.44
rrl 1475062 n.1405A>T non_coding_transcript_exon_variant 0.44
rrl 1475065 n.1409_1411delCAA non_coding_transcript_exon_variant 0.44
rrl 1475080 n.1425_1426delCC non_coding_transcript_exon_variant 0.5
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 0.58
rrl 1475093 n.1436C>T non_coding_transcript_exon_variant 0.25
rrl 1475104 n.1447T>A non_coding_transcript_exon_variant 0.59
rrl 1475108 n.1451C>T non_coding_transcript_exon_variant 0.31
rrl 1475111 n.1454G>A non_coding_transcript_exon_variant 0.31
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 0.62
rrl 1475116 n.1459G>A non_coding_transcript_exon_variant 0.29
rrl 1475119 n.1462C>T non_coding_transcript_exon_variant 0.31
rrl 1475124 n.1467A>T non_coding_transcript_exon_variant 0.69
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 0.31
rrl 1475515 n.1858G>A non_coding_transcript_exon_variant 0.29
rrl 1475517 n.1860C>T non_coding_transcript_exon_variant 0.43
rrl 1475518 n.1861A>G non_coding_transcript_exon_variant 0.57
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 1.0
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.29
rrl 1475538 n.1881T>A non_coding_transcript_exon_variant 0.75
rrl 1475538 n.1881T>C non_coding_transcript_exon_variant 0.8
rrl 1475539 n.1882A>T non_coding_transcript_exon_variant 0.75
rrl 1475540 n.1883C>T non_coding_transcript_exon_variant 0.38
rrl 1475545 n.1888T>G non_coding_transcript_exon_variant 0.88
rrl 1475548 n.1891C>T non_coding_transcript_exon_variant 0.5
rrl 1475549 n.1892T>C non_coding_transcript_exon_variant 0.25
rrl 1475550 n.1893A>C non_coding_transcript_exon_variant 0.43
rrl 1475551 n.1894T>G non_coding_transcript_exon_variant 0.38
rrl 1475555 n.1898T>G non_coding_transcript_exon_variant 0.33
rrl 1475564 n.1907C>A non_coding_transcript_exon_variant 0.33
rrl 1475574 n.1917C>G non_coding_transcript_exon_variant 0.4
rrl 1475576 n.1919C>A non_coding_transcript_exon_variant 0.27
rrl 1475596 n.1939G>T non_coding_transcript_exon_variant 0.2
rrl 1475599 n.1942A>G non_coding_transcript_exon_variant 0.33
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 0.43
rrl 1475722 n.2065G>T non_coding_transcript_exon_variant 0.65
rrl 1475751 n.2094C>A non_coding_transcript_exon_variant 0.21
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.66
rrl 1475754 n.2097G>A non_coding_transcript_exon_variant 0.14
rrl 1475756 n.2099T>C non_coding_transcript_exon_variant 0.14
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.63
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.68
rrl 1475803 n.2146T>C non_coding_transcript_exon_variant 0.15
rrl 1475804 n.2147G>C non_coding_transcript_exon_variant 0.15
rrl 1475816 n.2159C>G non_coding_transcript_exon_variant 0.15
rrl 1475817 n.2160A>G non_coding_transcript_exon_variant 0.16
rrl 1475869 n.2212C>A non_coding_transcript_exon_variant 0.5
rrl 1475881 n.2224T>C non_coding_transcript_exon_variant 0.78
rrl 1475883 n.2226A>C non_coding_transcript_exon_variant 0.82
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 0.85
rrl 1475898 n.2241A>G non_coding_transcript_exon_variant 0.44
rrl 1475899 n.2242G>A non_coding_transcript_exon_variant 0.92
rrl 1475900 n.2243A>G non_coding_transcript_exon_variant 0.25
rrl 1475916 n.2259C>G non_coding_transcript_exon_variant 0.88
rrl 1475937 n.2280A>T non_coding_transcript_exon_variant 0.29
rrl 1475943 n.2286G>A non_coding_transcript_exon_variant 0.93
rrl 1475945 n.2288C>A non_coding_transcript_exon_variant 0.32
rrl 1475952 n.2295A>G non_coding_transcript_exon_variant 0.92
rrl 1475963 n.2306G>A non_coding_transcript_exon_variant 0.58
rrl 1475970 n.2313C>T non_coding_transcript_exon_variant 0.84
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.57
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.83
rrl 1475978 n.2321C>T non_coding_transcript_exon_variant 0.54
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.76
rrl 1475996 n.2339T>A non_coding_transcript_exon_variant 0.36
rrl 1475997 n.2340A>G non_coding_transcript_exon_variant 0.58
rrl 1475998 n.2341C>T non_coding_transcript_exon_variant 0.58
rrl 1476001 n.2344T>C non_coding_transcript_exon_variant 0.58
rrl 1476024 n.2367T>G non_coding_transcript_exon_variant 0.18
rrl 1476025 n.2368G>T non_coding_transcript_exon_variant 0.18
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.33
rrl 1476033 n.2376T>C non_coding_transcript_exon_variant 0.36
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 0.36
rrl 1476045 n.2388G>C non_coding_transcript_exon_variant 0.36
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.25
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 0.18
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 0.18
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 0.18
rrl 1476130 n.2473G>A non_coding_transcript_exon_variant 0.23
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.31
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.18
rrl 1476164 n.2507A>G non_coding_transcript_exon_variant 0.17
rrl 1476165 n.2508T>A non_coding_transcript_exon_variant 0.39
rrl 1476179 n.2522C>T non_coding_transcript_exon_variant 0.16
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.66
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.7
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.55
rrl 1476207 n.2550T>C non_coding_transcript_exon_variant 0.14
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.64
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 0.26
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.61
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.45
rrl 1476250 n.2593C>G non_coding_transcript_exon_variant 0.26
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.41
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.3
rrl 1476256 n.2599A>T non_coding_transcript_exon_variant 0.21
rrl 1476257 n.2600G>C non_coding_transcript_exon_variant 0.29
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.55
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.35
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.26
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.39
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.5
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.5
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.44
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.5
rrl 1476301 n.2644A>C non_coding_transcript_exon_variant 0.44
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.41
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.75
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.7
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.56
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.69
rrl 1476337 n.2680C>T non_coding_transcript_exon_variant 0.17
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.42
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.3
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.75
rrl 1476359 n.2702C>G non_coding_transcript_exon_variant 0.23
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.2
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.68
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.23
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.74
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.74
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.62
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.25
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.86
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.28
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.85
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.71
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.93
rrl 1476513 n.2856G>T non_coding_transcript_exon_variant 0.15
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.59
rrl 1476515 n.2858C>T non_coding_transcript_exon_variant 0.28
rrl 1476517 n.2860C>T non_coding_transcript_exon_variant 0.53
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.58
rrl 1476523 n.2866T>C non_coding_transcript_exon_variant 0.83
rrl 1476524 n.2867C>A non_coding_transcript_exon_variant 0.84
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.86
rrl 1476528 n.2871A>G non_coding_transcript_exon_variant 0.16
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.74
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.29
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.9
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 0.27
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.74
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.74
rrl 1476567 n.2910C>T non_coding_transcript_exon_variant 0.6
rrl 1476573 n.2916A>C non_coding_transcript_exon_variant 0.53
rrl 1476577 n.2920T>G non_coding_transcript_exon_variant 0.54
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.89
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 0.43
rrl 1476586 n.2929C>T non_coding_transcript_exon_variant 0.15
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 0.53
rrl 1476596 n.2939C>T non_coding_transcript_exon_variant 0.19
rrl 1476600 n.2943A>C non_coding_transcript_exon_variant 0.26
rrl 1476601 n.2944G>A non_coding_transcript_exon_variant 0.17
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 0.47
rrl 1476607 n.2950C>T non_coding_transcript_exon_variant 0.26
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 0.3
rrl 1476613 n.2956G>A non_coding_transcript_exon_variant 0.17
rrl 1476614 n.2957A>G non_coding_transcript_exon_variant 0.67
rrl 1476614 n.2957A>T non_coding_transcript_exon_variant 0.73
rrl 1476616 n.2959A>G non_coding_transcript_exon_variant 0.25
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 0.78
rrl 1476624 n.2967T>G non_coding_transcript_exon_variant 0.34
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 0.72
rrl 1476628 n.2971T>G non_coding_transcript_exon_variant 0.5
rrl 1476629 n.2972C>A non_coding_transcript_exon_variant 0.37
rrl 1476630 n.2973A>G non_coding_transcript_exon_variant 0.54
rrl 1476633 n.2976A>G non_coding_transcript_exon_variant 0.22
rrl 1476637 n.2980C>G non_coding_transcript_exon_variant 0.25
rrl 1476638 n.2981C>T non_coding_transcript_exon_variant 0.25
rrl 1476661 n.3004A>G non_coding_transcript_exon_variant 0.21
rrl 1476664 n.3007T>A non_coding_transcript_exon_variant 0.46
rrl 1476668 n.3011C>T non_coding_transcript_exon_variant 0.54
rrl 1476675 n.3018C>A non_coding_transcript_exon_variant 0.44
inhA 1673338 c.-864G>A upstream_gene_variant 1.0
fabG1 1673370 c.-70A>G upstream_gene_variant 0.22
rpsA 1833646 c.105T>C synonymous_variant 0.19
rpsA 1833652 c.111C>T synonymous_variant 0.19
rpsA 1833661 c.120A>G synonymous_variant 0.17
rpsA 1833667 c.126C>T synonymous_variant 0.19
rpsA 1833668 p.Ile43Val missense_variant 0.19
rpsA 1833676 c.135A>G synonymous_variant 0.2
rpsA 1833679 c.138G>C synonymous_variant 0.19
rpsA 1833685 c.144G>T synonymous_variant 0.18
rpsA 1833688 c.147C>T synonymous_variant 0.17
rpsA 1833694 c.153G>C synonymous_variant 0.23
rpsA 1833727 c.186G>C synonymous_variant 0.24
rpsA 1833732 p.Pro64Leu missense_variant 0.21
rpsA 1833736 c.195C>T synonymous_variant 0.17
rpsA 1833742 c.201A>G synonymous_variant 0.24
rpsA 1833770 p.Asn77Asp missense_variant 0.13
rpsA 1833778 c.237C>T synonymous_variant 0.13
rpsA 1833781 c.240T>C synonymous_variant 0.15
rpsA 1833790 c.249T>C synonymous_variant 0.15
rpsA 1833823 c.282G>A synonymous_variant 0.18
rpsA 1833832 c.291G>A synonymous_variant 0.15
rpsA 1833955 c.414G>C synonymous_variant 0.2
rpsA 1833970 c.429G>C synonymous_variant 0.31
rpsA 1833979 c.438T>C synonymous_variant 0.33
rpsA 1833985 c.444G>C synonymous_variant 0.17
rpsA 1833988 c.447C>G synonymous_variant 0.15
rpsA 1833994 c.453G>C synonymous_variant 0.38
rpsA 1833997 c.456G>C synonymous_variant 0.31
rpsA 1834000 c.459G>C synonymous_variant 0.16
rpsA 1834009 c.468C>T synonymous_variant 0.2
rpsA 1834012 c.471G>C synonymous_variant 0.31
rpsA 1834015 c.474G>T synonymous_variant 0.14
rpsA 1834024 c.483G>C synonymous_variant 0.15
rpsA 1834025 p.Gln162Ala missense_variant 0.14
rpsA 1834030 c.489C>G synonymous_variant 0.13
rpsA 1834034 p.Ile165Val missense_variant 0.27
rpsA 1834040 p.Lys167Arg missense_variant 0.4
rpsA 1834046 p.Ile169Leu missense_variant 0.33
rpsA 1834054 c.513C>G synonymous_variant 0.36
rpsA 1834063 c.522C>T synonymous_variant 0.2
rpsA 1834093 c.552G>C synonymous_variant 0.29
rpsA 1834096 c.555G>C synonymous_variant 0.14
rpsA 1834114 c.573G>C synonymous_variant 0.17
rpsA 1834240 c.699T>C synonymous_variant 0.13
rpsA 1834249 c.708T>C synonymous_variant 0.14
rpsA 1834261 c.720A>G synonymous_variant 0.14
rpsA 1834264 c.723G>C synonymous_variant 0.13
rpsA 1834522 c.981C>G synonymous_variant 0.15
rpsA 1834523 p.Glu328Gln missense_variant 0.15
rpsA 1834540 c.999G>C synonymous_variant 0.18
rpsA 1834546 p.Asp335Glu missense_variant 0.18
rpsA 1834552 c.1013_1015delTTG disruptive_inframe_deletion 0.15
rpsA 1834570 p.Asp343Glu missense_variant 0.15
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2101921 c.1122G>A synonymous_variant 1.0
ndh 2103112 c.-70G>T upstream_gene_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168890 p.Ala575Ser missense_variant 0.15
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2290062 c.-821G>A upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
Rv2752c 3066286 c.-95C>T upstream_gene_variant 0.2
ald 3087084 c.266delA frameshift_variant 1.0
ald 3087184 c.368_373delCCGACG disruptive_inframe_deletion 1.0
Rv3083 3449004 c.502_504delCAC conservative_inframe_deletion 1.0
Rv3083 3449644 p.Ala381Thr missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
Rv3236c 3612866 p.Ser84Ile missense_variant 0.14
fbiB 3641595 p.Pro21Ser missense_variant 0.2
alr 3840932 c.489C>T synonymous_variant 1.0
alr 3841600 c.-180G>A upstream_gene_variant 0.12
rpoA 3878493 c.15G>A synonymous_variant 1.0
ddn 3986987 c.144G>T synonymous_variant 0.92
ddn 3987180 p.Asp113Asn missense_variant 1.0
clpC1 4038854 p.Lys617Arg missense_variant 0.17
clpC1 4038860 c.1845G>T synonymous_variant 0.29
clpC1 4038863 c.1842G>C synonymous_variant 0.29
clpC1 4038878 c.1827A>G synonymous_variant 0.38
clpC1 4038899 c.1806C>G synonymous_variant 0.33
clpC1 4039838 p.Leu289Ile missense_variant 0.17
clpC1 4039850 c.855T>C synonymous_variant 0.17
clpC1 4039865 c.840T>C synonymous_variant 0.27
clpC1 4039875 p.Asn277Arg missense_variant 0.25
clpC1 4039880 c.825G>A synonymous_variant 0.2
clpC1 4039898 c.807C>G synonymous_variant 0.41
clpC1 4039904 c.801A>G synonymous_variant 0.41
clpC1 4039907 c.798G>A synonymous_variant 0.29
clpC1 4039929 c.775_776delAGinsTC synonymous_variant 0.25
clpC1 4039931 c.774T>C synonymous_variant 0.31
clpC1 4039934 c.771G>A synonymous_variant 0.23
clpC1 4039940 c.765G>C synonymous_variant 0.14
clpC1 4039946 c.759A>T synonymous_variant 0.25
clpC1 4039949 c.756G>C synonymous_variant 0.15
clpC1 4039952 c.753T>C synonymous_variant 0.38
clpC1 4039958 c.747G>C synonymous_variant 0.21
clpC1 4039966 p.Leu247Val missense_variant 0.14
clpC1 4040024 c.681A>G synonymous_variant 0.12
clpC1 4040033 c.672G>C synonymous_variant 0.12
clpC1 4040063 c.642G>C synonymous_variant 0.13
clpC1 4040066 c.639G>C synonymous_variant 0.17
clpC1 4040069 c.636G>C synonymous_variant 0.2
clpC1 4040090 c.615T>C synonymous_variant 0.18
clpC1 4040096 c.609G>C synonymous_variant 0.22
clpC1 4040114 p.Ile197Met missense_variant 0.18
clpC1 4040117 c.588A>G synonymous_variant 0.23
clpC1 4040125 p.Glu194Lys missense_variant 0.15
clpC1 4040824 c.-120C>T upstream_gene_variant 1.0
embC 4239843 c.-20A>C upstream_gene_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embA 4244635 p.Val468Ala missense_variant 1.0
embA 4245147 p.Pro639Ser missense_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 0.91
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
aftB 4269630 c.-794G>A upstream_gene_variant 1.0
ethA 4326181 c.1293C>T synonymous_variant 0.15
ethR 4326928 c.-621G>A upstream_gene_variant 1.0
ethA 4327103 p.Gly124Asp missense_variant 1.0
ethA 4327464 p.His4Asn missense_variant 0.85
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0