TB-Profiler result

Run: SRR11342668

Summary

Run ID: SRR11342668

Sample name:

Date: 2024-04-14T03:07:12.503179

Number of reads: 3425701

Percentage reads mapped: 92.57

Median coverage: 112.5

Strain: lineage4.8.1

Spoligotype:

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4 Euro-American None 1.0
lineage4.8 Euro-American (mainly T) RD219 1.0
lineage4.8.1 Euro-American (mainly T) RD219 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Asp435Val Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Val Assoc w R
pyrazinamide pncA p.Leu151Ser Assoc w R
streptomycin rpsL p.Lys43Arg Assoc w R
rrs n.888G>A Uncertain significance Mutation from literature
fluoroquinolones
moxifloxacin gyrB p.Glu501Asp Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ofloxacin
levofloxacin gyrB p.Glu501Asp Assoc w R - Interim
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrB 6742 p.Glu501Asp missense_variant 1.0 moxifloxacin Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
levofloxacin Assoc w R - Interim
rpoB 761110 p.Asp435Val missense_variant 0.82 rifampicin Assoc w R
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.62 streptomycin Uncertain significance Mutation from literature
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2288790 p.Leu151Ser missense_variant 1.0 pyrazinamide Assoc w R
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
rpoC 764566 c.1197C>G synonymous_variant 0.4 rifampicin Not assoc w R - Interim
rpoC 764581 c.1212T>C synonymous_variant 0.37 rifampicin
rpoC 764582 p.Leu405Met missense_variant 0.37 rifampicin
rpoC 764605 c.1236G>C synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoC 764623 c.1254C>G synonymous_variant 0.14 rifampicin Not assoc w R - Interim
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472123 n.278A>G non_coding_transcript_exon_variant 0.11 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472124 n.279C>T non_coding_transcript_exon_variant 0.23 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.31 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472151 n.306C>A non_coding_transcript_exon_variant 0.27 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472155 n.310C>T non_coding_transcript_exon_variant 0.25 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472160 n.315C>T non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 0.39 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472210 n.365A>C non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472213 n.368G>C non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472215 n.370A>G non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472225 n.380C>A non_coding_transcript_exon_variant 0.22 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Uncertain significance
rrs 1472234 n.389T>C non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.42 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472258 n.413A>G non_coding_transcript_exon_variant 0.18 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472259 n.414C>A non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472282 n.437T>G non_coding_transcript_exon_variant 0.14 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472285 n.440A>G non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472293 n.448C>A non_coding_transcript_exon_variant 0.19 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472295 n.450A>C non_coding_transcript_exon_variant 0.12 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472338 n.493A>G non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472344 n.499C>T non_coding_transcript_exon_variant 0.21 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472379 n.534T>C non_coding_transcript_exon_variant 0.21 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472400 n.555C>T non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472422 n.577T>C non_coding_transcript_exon_variant 0.15 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Uncertain significance
rrs 1472427 n.582T>G non_coding_transcript_exon_variant 0.12 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472476 n.631A>G non_coding_transcript_exon_variant 0.1 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472494 n.649A>G non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472507 n.662C>G non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472513 n.668T>C non_coding_transcript_exon_variant 0.13 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472517 n.672T>A non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472518 n.673G>T non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.3 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472544 n.699C>A non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472549 n.704G>A non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472566 n.721G>A non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472579 n.734G>C non_coding_transcript_exon_variant 0.39 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472580 n.735C>T non_coding_transcript_exon_variant 0.3 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.6 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472584 n.739A>T non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.49 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.77 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.59 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.55 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472670 n.825_830delGGGTTTinsTAGAC non_coding_transcript_exon_variant 0.6 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472680 n.835C>T non_coding_transcript_exon_variant 0.34 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.64 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472692 n.847T>C non_coding_transcript_exon_variant 0.17 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.4 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472700 n.855C>T non_coding_transcript_exon_variant 0.12 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.55 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.18 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.64 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.62 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472767 n.922G>A non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472790 n.945T>C non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.51 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.4 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.42 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472825 n.980G>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472827 n.982G>T non_coding_transcript_exon_variant 0.21 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.39 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472836 n.991G>C non_coding_transcript_exon_variant 0.19 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472838 n.993_998delACAGGAinsCTCTGAC non_coding_transcript_exon_variant 0.18 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472846 n.1002delG non_coding_transcript_exon_variant 0.16 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472874 n.1029C>A non_coding_transcript_exon_variant 0.13 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472880 n.1035_1036insA non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472892 n.1047T>C non_coding_transcript_exon_variant 0.11 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472951 n.1106T>C non_coding_transcript_exon_variant 0.24 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472953 n.1108G>A non_coding_transcript_exon_variant 0.29 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472954 n.1109T>C non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.37 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.49 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472958 n.1113A>G non_coding_transcript_exon_variant 0.17 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472970 n.1126delG non_coding_transcript_exon_variant 0.15 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.47 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472974 n.1129A>G non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472975 n.1130T>G non_coding_transcript_exon_variant 0.15 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472982 n.1137G>A non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472988 n.1143T>C non_coding_transcript_exon_variant 0.2 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472992 n.1147A>G non_coding_transcript_exon_variant 0.17 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473001 n.1156G>C non_coding_transcript_exon_variant 0.23 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473002 n.1157G>A non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473004 n.1159T>A non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473005 n.1160C>T non_coding_transcript_exon_variant 0.2 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473008 n.1163C>T non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473009 n.1164T>G non_coding_transcript_exon_variant 0.23 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473020 n.1175T>C non_coding_transcript_exon_variant 0.22 streptomycin Uncertain significance
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.76 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473053 n.1208T>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.6 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.75 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473062 n.1217T>A non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.65 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473080 n.1235C>T non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473081 n.1236C>T non_coding_transcript_exon_variant 0.25 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.73 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.38 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.7 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473101 n.1256C>T non_coding_transcript_exon_variant 0.17 streptomycin
kanamycin Uncertain significance
capreomycin
amikacin Uncertain significance
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.16 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.69 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.13 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.63 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473130 n.1285G>A non_coding_transcript_exon_variant 0.28 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473148 n.1303G>T non_coding_transcript_exon_variant 0.34 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473163 n.1318C>A non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473172 n.1327T>G non_coding_transcript_exon_variant 0.28 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473173 n.1328C>T non_coding_transcript_exon_variant 0.57 streptomycin Not assoc w R
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473205 n.1360T>C non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473221 n.1376C>T non_coding_transcript_exon_variant 0.51 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473249 n.1404T>C non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.48 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.45 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473262 n.1417T>C non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473276 n.1431A>C non_coding_transcript_exon_variant 0.53 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473277 n.1432G>A non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473281 n.1436C>G non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1473282 n.1437C>G non_coding_transcript_exon_variant 0.11 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473283 n.1438T>C non_coding_transcript_exon_variant 0.13 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473284 n.1439A>T non_coding_transcript_exon_variant 0.12 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473287 n.1442_1449delCCTCGGGAinsG non_coding_transcript_exon_variant 0.24 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>G non_coding_transcript_exon_variant 0.48 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473305 n.1460G>T non_coding_transcript_exon_variant 0.12 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473314 n.1469A>G non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1473315 n.1470T>C non_coding_transcript_exon_variant 0.25 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473316 n.1471C>T non_coding_transcript_exon_variant 0.52 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473318 n.1473G>A non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473319 n.1474C>T non_coding_transcript_exon_variant 0.27 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473327 n.1482A>G non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473328 n.1483C>T non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473352 n.1507C>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Not assoc w R
rrl 1474197 n.540C>T non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474275 n.618T>G non_coding_transcript_exon_variant 0.22 capreomycin
linezolid
rrl 1474308 n.651G>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 0.21 capreomycin
linezolid
rrl 1474315 n.658A>G non_coding_transcript_exon_variant 0.14 capreomycin
linezolid
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474353 n.696A>G non_coding_transcript_exon_variant 0.18 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474355 n.698A>G non_coding_transcript_exon_variant 0.18 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474393 n.736A>G non_coding_transcript_exon_variant 0.24 capreomycin
linezolid
rrl 1474402 n.745T>C non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474414 n.757_778delCCCACACGCGCATACGCGCGTGinsT non_coding_transcript_exon_variant 0.25 capreomycin
linezolid
rrl 1474437 n.781_782delAA non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid
rrl 1474448 n.791T>C non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid
rrl 1474467 n.810A>G non_coding_transcript_exon_variant 0.45 capreomycin
linezolid
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474495 n.838G>A non_coding_transcript_exon_variant 0.5 capreomycin
linezolid
rrl 1474498 n.841G>T non_coding_transcript_exon_variant 0.39 capreomycin
linezolid
rrl 1474505 n.848C>G non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474506 n.849C>T non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474508 n.851C>T non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474516 n.859C>A non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474527 n.870T>C non_coding_transcript_exon_variant 0.47 capreomycin
linezolid
rrl 1474529 n.872A>G non_coding_transcript_exon_variant 0.11 capreomycin
linezolid
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474540 n.883T>C non_coding_transcript_exon_variant 0.11 capreomycin
linezolid
rrl 1474542 n.885A>G non_coding_transcript_exon_variant 0.48 capreomycin
linezolid
rrl 1474551 n.894G>A non_coding_transcript_exon_variant 0.13 capreomycin
linezolid
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474634 n.977T>C non_coding_transcript_exon_variant 0.38 capreomycin
linezolid
rrl 1474636 n.979A>C non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid
rrl 1474658 n.1001A>G non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1474663 n.1006C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474677 n.1020A>G non_coding_transcript_exon_variant 0.63 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474692 n.1035G>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474709 n.1052G>A non_coding_transcript_exon_variant 0.32 capreomycin
linezolid
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.13 capreomycin Uncertain significance
linezolid
rrl 1474734 n.1077G>T non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474779 n.1122G>A non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474780 n.1123C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474782 n.1125G>A non_coding_transcript_exon_variant 0.33 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.62 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474801 n.1144G>A non_coding_transcript_exon_variant 0.26 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474802 n.1145T>C non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474824 n.1167A>G non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474831 n.1174A>G non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1474832 n.1175A>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474864 n.1207C>T non_coding_transcript_exon_variant 0.54 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474901 n.1244A>G non_coding_transcript_exon_variant 0.17 capreomycin
linezolid
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 0.23 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474933 n.1276A>G non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475026 n.1369G>C non_coding_transcript_exon_variant 0.12 capreomycin
linezolid
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid
rrl 1475059 n.1403_1404insTA non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475062 n.1405A>T non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid
rrl 1475065 n.1409_1411delCAA non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475076 n.1419_1422delCCTTinsGCCCTA non_coding_transcript_exon_variant 0.17 capreomycin
linezolid
rrl 1475080 n.1425_1426delCC non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 0.17 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475104 n.1447T>A non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475124 n.1467A>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475673 n.2016T>C non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475696 n.2039T>C non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475703 n.2046A>G non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475715 n.2058G>C non_coding_transcript_exon_variant 0.21 capreomycin
linezolid
rrl 1475722 n.2065G>T non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475751 n.2094C>A non_coding_transcript_exon_variant 0.5 capreomycin
linezolid
rrl 1475752 n.2095C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.18 capreomycin Uncertain significance
linezolid
rrl 1475754 n.2097G>A non_coding_transcript_exon_variant 0.22 capreomycin
linezolid
rrl 1475756 n.2099T>C non_coding_transcript_exon_variant 0.42 capreomycin
linezolid
rrl 1475761 n.2104_2108delCGCAAinsTTC non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.18 capreomycin
linezolid
rrl 1475774 n.2117C>T non_coding_transcript_exon_variant 0.23 capreomycin
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475777 n.2120A>T non_coding_transcript_exon_variant 0.46 capreomycin
linezolid
rrl 1475869 n.2212C>A non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475881 n.2224T>C non_coding_transcript_exon_variant 0.35 capreomycin
linezolid
rrl 1475883 n.2226A>C non_coding_transcript_exon_variant 0.43 capreomycin Uncertain significance
linezolid
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475896 n.2239A>G non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1475898 n.2241A>G non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid
rrl 1475899 n.2242G>A non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid
rrl 1475900 n.2243A>G non_coding_transcript_exon_variant 0.16 capreomycin Uncertain significance
linezolid
rrl 1475906 n.2249C>T non_coding_transcript_exon_variant 0.26 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475916 n.2259C>G non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475937 n.2280A>T non_coding_transcript_exon_variant 0.39 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475943 n.2286G>A non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475945 n.2288C>A non_coding_transcript_exon_variant 0.22 capreomycin
linezolid
rrl 1475952 n.2295A>G non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475970 n.2313C>T non_coding_transcript_exon_variant 0.2 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.17 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.13 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476001 n.2344T>C non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476135 n.2478T>C non_coding_transcript_exon_variant 0.1 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476141 n.2484A>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476153 n.2496T>C non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476164 n.2507A>G non_coding_transcript_exon_variant 0.17 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476165 n.2508T>G non_coding_transcript_exon_variant 0.2 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.45 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476195 n.2538C>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476196 n.2539C>A non_coding_transcript_exon_variant 0.23 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.39 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.32 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476204 n.2547C>A non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476215 n.2558C>A non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.2 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476225 n.2568T>G non_coding_transcript_exon_variant 0.4 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476227 n.2570C>T non_coding_transcript_exon_variant 0.24 capreomycin
linezolid Uncertain significance
rrl 1476229 n.2572C>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476250 n.2593C>G non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.54 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476255 n.2598A>G non_coding_transcript_exon_variant 0.11 capreomycin Uncertain significance
linezolid
rrl 1476256 n.2599A>G non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476257 n.2600G>C non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.7 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.63 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.7 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.66 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476357 n.2700T>C non_coding_transcript_exon_variant 0.18 capreomycin
linezolid
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.72 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476359 n.2702C>T non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.55 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.74 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476411 n.2754G>A non_coding_transcript_exon_variant 0.29 capreomycin
linezolid
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.82 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476443 n.2786G>C non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1476455 n.2798C>G non_coding_transcript_exon_variant 0.16 capreomycin
linezolid
rrl 1476463 n.2806C>T non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.46 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476470 n.2813C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.75 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.81 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476513 n.2856G>T non_coding_transcript_exon_variant 0.24 capreomycin
linezolid
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476515 n.2858C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid
rrl 1476517 n.2860C>T non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.39 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476523 n.2866T>C non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476524 n.2867C>A non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476528 n.2871A>G non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476537 n.2880A>G non_coding_transcript_exon_variant 0.12 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.59 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476542 n.2885T>C non_coding_transcript_exon_variant 0.11 capreomycin
linezolid
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476567 n.2910C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.46 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476600 n.2943A>C non_coding_transcript_exon_variant 0.2 capreomycin
linezolid
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 0.26 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476614 n.2957A>T non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1476616 n.2959A>G non_coding_transcript_exon_variant 0.21 capreomycin
linezolid
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 0.26 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476628 n.2971T>G non_coding_transcript_exon_variant 0.15 capreomycin
linezolid
rrl 1476629 n.2972C>A non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid
rrl 1476633 n.2976A>G non_coding_transcript_exon_variant 0.13 capreomycin
linezolid
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
PPE35 2168149 p.Pro822Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2170892 c.-280G>A upstream_gene_variant 1.0 pyrazinamide
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2680 2995848 c.-257G>A upstream_gene_variant 1.0 capreomycin
fbiD 3339040 c.-78T>C upstream_gene_variant 1.0 clofazimine
pretomanid
delamanid
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0 ethionamide Uncertain significance
fbiB 3642874 p.Leu447Arg missense_variant 1.0 clofazimine Uncertain significance
pretomanid
delamanid Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R